Transcript

chordc1a-201

ID
ZDB-TSCRIPT-131113-1290
Name
chordc1a-201
Previous Names
  • ch1073-257b5.1-001
  • chordc1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057913 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057913|OTTDARG00000040360|ZDB-GENE-050626-79 chordc1a|OTTDARP00000047752 CH1073-257B5.1-001 LG_ CU695176.4 Danio rerio protein_coding KNOWN, 1381 bp
CCGATTTATTTCCGTTGCTGCGGTCGGGTGTCAGAGAAAA
GTTCGCGAATTTTCCCGAGCGCCTCGCGTGAATTTCCGGG
CAGAGGTACAGACAGACGCACGCCAGACACATCAAGACGA
ACGTTTAGTGCAATAAAATAAACAATTTTCAGCTATTATA
TCTCGTAAATACCTCATTTGTGTCGTGAAGCGTCCGCAAT
GTCAGCGCTGTGTTATAATAAAGGCTGCGGGCAGCGATTC
GATCCTGAAAACAACCCGGACGATTCCTGCACGCATCATC
CTGGAGTCCCCGTGTTTCATGATGCTCTGAAGGGTTGGTC
GTGCTGTAAGAGACGAACAACAGACTTCTCTGATTTTCTT
AGTATTGCGGGCTGCACTAAAGGTCCTCATAACAAAGAGA
AGCCGCTTGAACCAGTGAAACCAGACGTGAAGGTTTCAGG
AGAGAAGAAAGAGCTGGAGGATCTCAAACCCAAGTTTAAT
GAGTACATCATTCAAGCACCAAAACCAGTGGAGTTCATCC
AGAGACCCAGTGCTGATGAGCCACTGGTGAACCTGCAGAG
GAAAGTTGCTCCATCTCTGAATCAGGCTCTCGAGAAGCTC
AGACTCGCAGAAGAAGCCAATCACATTGAAGAAAAAGAAG
AGGAAGGAAGTGAAGTCAAAGTCGGGACCGCGTGTAAAAA
TGGAGGTTGCATGAAGACATACAACGGACCAAAGACCGAT
GAAGAGATGTGTTTATATCATTCTGGAGTTCCCATTTTTC
ATGAGGGGATGAAGTACTGGAGCTGCTGTAAGAGGAAGAC
GTCTGATTTTAACACTTTTCTGTCTCAGGAGGGCTGTAAT
AAAGGCTCACACCAGTGGAGGAAAGACACGGGTAATAAAG
TGGCTCCGTGTAGGTTTGATTGGCATCAGACAGGAAGTCA
GGTGACCTTGTCCATCTATGCAAAAAACTCCAACCCGCAG
CTCTGCTCTGTGGAGGCCAACAGCGTCTCGCTGAAAGTCC
ATCTGATCTTTGAGGGAGAAAAGGAGTTTGAGCTGAGCCT
GAGTCTGTGGGGAGTCATTGACGTCAGTAAGAGTGTGGTT
AATATGATGGCTTCCAAAGTGGAAGTAGTAATGAAGAAGG
CGGAGCCTATGTCCTGGGCCCGGCTGGACCTGCCCCCTCC
AAAACCGACCAATGAGATGAAGGAGAATCAAGACGGACAG
AACGTGACTGTTCAGTGACAGCAGCGGTCAGTGATGAGGA
CTTCAGTCAAACCCTGCTTTCTGAATAATCTGGGGAATCA
AATGAGAGATTATTTATTTATTTAATTGGTGACCATGAAT
ATGGAGGAGGATTAGGGCCAAGGATTATTAATAAAATAAA
TAAAATCATTTTGAGGTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations