header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1189
Transcript Name: si:ch211-167j9.4-201
Previous Names: ch211-167j9.4-001, si:ch211-167j9.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057384 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057384|OTTDARG00000040005|ZDB-GENE-131121-196 si:ch211-167j9.4|OTTDARP00000044973 CH211-167J9.4-001 LG_ CR848814.7 Danio rerio protein_coding PUTATIVE, 2039 bp
GATTGGCCGCGGAATAAGGCAGGGGTGCCCTTTGTCACCG
TTTTTATTTATTTTAGCGGTAGACATGTTAGCTACAAAAA
TTAAATATGATAATTCAGTGGAGAAATTAAATATTTTCGG
AAAAACAATAGGAATTAGTCAGCTAGCGGACGACACCACA
TTATTTTTAAAAAATAAAGACCAAATTTCTCCAGCTATCT
CTTTAATTAGTTCTTTTTGTAAAGCATCTGGCCTCCAATT
AAATTTAAACAAATGTGAACTTTTAGCTCTTCACCCTAGT
CCAGATCTATCCCTGTTTAACATCCCAGTAAAAGAAACTG
TGAAATATTTAGGCATTTTGATCTCAAAAGATTCAAACAT
TAACATCAAAGAAAACTTTGAAAATAAAGTACATAAAGCT
AATGGTATCCTGAATTGCTGGCTGCAGAGAGATATTTCCA
TTTTTGGACGAATTCTTCTATCCAAGGTTGAATATCTATC
AAAACTAATTTATCCTGCTCAAGCTTTAGCTCCCTCTTCA
GCAATCATAAAAACAAGTAACCAAAAAATGTATGACTTTA
TTTGGAGACACAAAACCCATTATATTAAAAAATCTGATAT
TATCAAATCGTATGAAGAAGGTGGTCTTAATATTATTGAG
TTCGAAAGTATGAATAGTATGTTAAAACTGAAATGGCTTC
AAAGGTTTTTGAGTAATACTGAGAGTTTCTGGTACACTGT
TCCTTGTGCCTTGTTTAACAAACTAGGTGGCATCCGATTT
CTTCTCAGATGTGATTTTGACTTGCCTAAACTCCCAGTGA
AGCTTTCAGCATTCCACCAACAAGTCTTGCTGTCTTGGAA
ACTAGCGCACACACACAATTTTACACCTCACAATACCCCT
ATTTGGAATAACAAGTATATTCTACACAGGAACAAATCCA
TTTTTTATGAAGAATGGTTAAATAAAAATATTTGGTCAGT
AACAGACTTAATGGATGGAAGGGGCAATATTCTAGATTAC
AATACTTTCACTCTAAGACACGGATTTGCTTGTCATCCAA
AGCAATTTTTCACTGTTATTAATGCTATACCCTCAGGTAT
AAAAATGTTAATGAAAAGTTACCTATCCTATTCGAAAATT
ACTCCAGTCCTTCCCTTATTATATACTGGTGAGATTGAAT
TTGATAATAAACTTTGCACTAATAAACATTTAAGACAAAT
TATTATCCAATCTTGTTTCCCTTATCAAGTATTAAGAAAT
AGGTTATTTCATTCAGTGGATAAAAATACTGTTAAATATT
TTAGAACAACTTATCTTAAATTTCCAATTCTCCCCAAGGC
AAAAGAAGTACAATTTAAAATATTAAATGATATATACCCT
TCTAATAGATTCTTACACCTAAAATTTAACTTAGAAAACT
CACCATGCCATTTATGTAAACACTTTAGTGAAGACACAGA
ACACATATTTTTCTCTTGCAACGCCGTTCAATCATTGTGG
AAAAAAGTACAAGACTGGTTGATAATAAAAAACGTGGTTG
CTGAAGGTTCGACTTTTACATTACAAAATGTACTATATGG
AATTACTAAAGATGGTTCTACTTTGCACGATTTGATAAAT
ATGATAATTGTGTTAGCCAAATATTTTATTCATAAATGTA
GATATTTCAAAACTCCTCCATTACTTATTGTATTTAAAAA
AGAACTTAAAATATTTTCAGATGCCCTGGTTAAAATGAAA
ACAAAAAATGCCTTAAAAATGTTCAATTTATTTGTTATAT
ATAACTTGCCATAGATGATATATGTTGTACTTAATTTTTA
TTTATTTACTCATTTAATTTTTGCTTTTTCCTTTCACTAT
TGGATTTATTTAACTTGAATGTTTTTTGTATATTACATTT
GTATCTTTGTATATTATTTTGTGTTGAGCCTTCCATATAT
AACACACAAGTTGTAAAGTTGAATCCCATTTTGTTGTATT
TGGATTTTGTATTTTCAATAAAAAAAATAAATAAATAAAT
AAATAAAAAAAAAAAATAAATAAAAAAACAAGGGCAAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-167j9.4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057384 (1),  Ensembl_Trans:ENSDART00000154885 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN513016 (1) 867 bp
GenBank:CT642712 (1) 781 bp
GenBank:CT668541 (1) 754 bp
GenBank:CT642713 (1) 650 bp
GenBank:EB862475 (1) 417 bp
CITATIONS (2)