Transcript

igl4v9-201

ID
ZDB-TSCRIPT-131113-1056
Name
igl4v9-201
Previous Names
  • igl4v9-001
  • dkey-234i14.18-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056842 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056842|OTTDARG00000039624|ZDB-GENE-051013-8 igl4v9|OTTDARP00000044593 DKEY-234I14.18-001 LG_ CU207301.28 Danio rerio protein_coding PUTATIVE, 456 bp
TTGATGACTGAGAGCAGAACAAACACAATCTTCATCATCA
TCATCATCATCATCATCATCATCATCACAGCAGACTCAAC
TACAGCTATGATCAACATCTGCATCTGCATCTGGACCGTT
GCTGTCTTCATTCATGGATCATCAGGAGTCACTTTGACTC
AACCTGAAGTTAAAACTGTCCAACAAGACGAAACAGCCAC
AATAGAGTGTCACATAGATGTGGGAATATACAGCAACTAT
TTAGCCTGGTATCAGCAGAAACCTGGAGAAACTCCTAAAC
TCCTGATCTATCGGATAAACAACCGTTACTCAAACACTCC
ATCTAGATTCAGTGGTGGTGGAACAGTGAATACTGGAAAA
GATTTTACTCTGAGCATCAGTGGAGTCCAGACTGAAGATG
CTGCAGATTATTACTGTCAGAATGTAGACTGTTCTGGTAG
TAGCTGTGTGTTCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations