Transcript

si:ch211-196c10.13-201

ID
ZDB-TSCRIPT-130528-675
Name
si:ch211-196c10.13-201
Previous Names
  • ch211-196c10.13-001
  • si:ch211-196c10.13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058686 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058686|OTTDARG00000040726|ZDB-GENE-130603-71 si:ch211-196c10.13|OTTDARP00000045850 CH211-196C10.13-001 LG_ CR759927.12 Danio rerio protein_coding NOVEL, 767 bp
AAAGGACGTCAGACGTGGATGAATATTACAATCATATTTG
GCATCAGAATGAACATCTGGAAAATGAATCCAATGGCAGT
TGTTGGTGACCCGCGCTTCTACACCAGTATGGGCTGCGCG
CGCCTCGGTGAAGGAGATCCCGCGCATCCCTTCGACAATT
TCACCACAAGCCATCAAATTATCGATGTGACGACATCAGC
GGAGACCGACAGAAAAAGTTTCCAGGGTCTGGAAAGTGGA
TGTCACGGAAACTCGGTGTCGAGCAGCAGGACAGTCAAAG
AGCCAGGCGCGCTGCGGTTGTTAATCAATGCGCGTGAACG
AAGGCGCATGCACGATCTCAACGAAGCGCTGGATGACCTG
AGGGCTGTCATTCCGTACACGTCGAACCGCAAGGTGAAGA
AATTGTCCAAGATAGCGACACTTCTCCTGGCCAAGAACCA
CATCCTGATGCAGGCTCGAGCCTTGAAGGAGATGCGGAGG
ATAGTAGAGCAGATGGATGTGACACAGAATGTTATGATGC
CACCTTACACGCTGTCACATATATAGACTGTCAGTGTGTT
TTTGTTTCTTAGCATGTGAGCAATCTGATGATAATTATAC
ACCTAAAATGTATTGTTTCAGGTTCTTGCTTGTGTAAATA
ATATTGTAAGGACATCATTTGTTCCATATGTGCATGGTCT
TTGAAACATTTTTCTATCTTTTCTTCTCTTCTTTTCTTCT
ATCATCTACGTTTTATAGTGCAATGACGAATAAATATATA
TTTCTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations