Transcript

rnf217-202

ID
ZDB-TSCRIPT-130528-420
Name
rnf217-202
Previous Names
  • rnf217-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058682 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058682|OTTDARG00000015661|ZDB-GENE-060503-400 rnf217|OTTDARP00000045849 rnf217-002 LG_ BX936317.16 Danio rerio protein_coding KNOWN, 1912 bp
ACTCGGTGTTTTTAGTTTGTGAGTTTGAAACCGGACTGTG
TGTGTTTTTCGCTCAAATGGAAAGTTGACCGCTCAGGAAT
GGAAGATGAGTCTTCCGTGCGAGTGAATGACACCACGCGA
AATATGCCCGGTTATTCCGGACGCGACGGGGAATCTGTCT
ATGTATCCAGCGGGACACGGAGCACTGATTTCGGCCAGGA
TGTCCGCAGCGGTGAGGCGAAGGTGCCGTCATCGTCATCA
TTATCCTCGAAGGATGTTTTGGAATTTCATAAACACAAAC
ATGGACCAGGAGGCGGCCACAGAGAACATATCGAGAGGGA
AAACATAAGAGCTGTGGATATTTTAAGAAGGAATTTTGGT
TCCACTATCAGAGATACAGAAGATCCCAAAAATCTAGAGA
AAGTAGGAAATGACATCAATCTAAACGACTTGGACCATGA
AAATGATGATGAAAGGTTGCAATGTAGCACAATAAATCTA
CAACAAGATATTGAGAGCAATCCAGAATTGGGAAATCCTG
ATGGGAATCATCATATTGATTATAACATTGATTTGAAGAG
TGGCGAAGATCCCAGCCAATCAAAAGAGCATGTTTACTGC
ACTGTATACTGTATAGCCAATGATAATTATAGGATACCTG
TTCAGAAAACAACATCCAATCACGAGACTTCATCATCATC
ATCATCATCATCTTCTTCATCTTCTTCTTCCCCAGATGTA
CTGGTTTTACCATCCACCGACTTACCAAACTTAGAATTGG
ACAATCATGATCCCTACCCAGTGCCCTATACCGTCTCTGA
CCTGATGGTGTCTGGAATACACAGCTCATATAATGCTGAC
AACAGTTTGTCTGTGGTGTTGACATGTCGCATTTGTCTTG
ACGATAAACAAATCATGCCGCTACACTGTTGCAAAAAGGC
TGTTTGTGAAGAATGTCTGAAAAGATACATCATCTCACAG
GTTCACGTGGGTCGAGCGCACTTGGTGTGTCCCATCACAG
AGTGCAGCGGTTTCTTGGAGGAGAACTTGGTGATTTCACA
CCTGACCAGTGAGGAACTTGCAAAATACAAGTACTTTTTG
GAACTGAGCCAATTGGACTCCAGCACAAAACCGTGTCCTC
AGTGCAGCCTGTTTACATCCTTGAGGGGTCGCAGCCAACA
GTCGTCCACCAAGAGTGAACATAAGTATAAGATTCAGTGC
ACCAAGTGCCAGTTTGTCTGGTGTTTTAAATGCCACTCGC
CCTGGCATGAAGGCCTGAAGTGTCGGGACTACAGGAAAGG
AGACAAACTGTTGCGCCACTGGGCCAGTGTCATCGAACGT
GGCCAGAGGAACGCTCAGAAATGCCCACGCTGCAAGATCC
ACATTCAGAGAACGGAGGGCTGTGATCACATGACATGCAC
ACAATGCAGCACTAACTTTTGTTACCGTTGTGGGGAGAAG
TACAGACATCTGCGCTTCTTCGGGGACCACACTTCCAACC
TGAGTGTGTTTGGATGCAAATACCGCTACCTGCCAGAGAA
ACCGCACCTACGACGGCTGGTCCGAGGCTCCGTCTGCATG
AGTAAAATGCTGGTGGCTCCCGTGGTCATTGTCCTGGTGG
TGGTTGTCGGAGCTCTGGCTTTGGTCGTAGGTAATCCTAT
ACCCACTCTATAATATTCAGGTCTGGATCCCGTGGAGTCC
AGTTCATTACTGTCAATACTTTATCGGCTGCTTTTCCTCC
AGCTATAATTTCCATTTTCAGATGAAGAATGATATTACAA
CTATTATAAACCATTGATAGAAAAACAAAAACAAATCTAA
GACTTTTGCAATGTACTGTACATTTTTAATGGAATTTGAA
TATTTCACAATCCTTTCATGAATCTTTTTGGAACCGTTAA
AATTTGTATTGTTCAATAAATGTATGTTGCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations