Transcript

nfe2l1b-203

ID
ZDB-TSCRIPT-130528-363
Name
nfe2l1b-203
Previous Names
  • nfe2l1b-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058506 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058506|OTTDARG00000040648|ZDB-GENE-120319-2 nfe2l1b|OTTDARP00000045732 nfe2l1b-003 LG_ BX248092.16 Danio rerio protein_coding KNOWN, 502 bp
AGCGGAAGTGTGAGAGGTCAATACTTCACAGCGCCTGGAC
AAATAAATTGTCTTTAGACGAGGTTTTAGAAGGATGTGGT
GAAAATAGACAATAAACGACGGAGTTCAGTCACCGATCTG
CTGTTATTGACGGCGAACATGCGGGATTCCTTTAAGGATA
TCACGTTTTTTGAGGAAAAACTCATGCTTGCAGATATAAC
CTGGATATTATTTGGGGCGCAAAAGCGTTAATCAAAAACA
AAAGTGGATTCAACTTTAGTAGTATTTAATTAAAAGCACA
TGACTGTGGAACAAAGCGAGCATCATTTTATGTTGTGTCT
GCTTTTGATTTTTTATTATATACAAGGTTAAACGTAACCT
AATTTGGTTTGACGTTTGTTTGCGTGATTTGTTTTTCTTT
TTTTTGCTTTTTAGTTGCTTTTTGAGTTTTCTTTTTTGTT
CCTTTGCAAAGAAATGCTTTACTTGAAAAAGTACTTCACA
GAGGGTCTTATTCAGTTCACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations