header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-894
Transcript Name: ctslb-203
Previous Names: dkey-239j18.4-001, ottdart00000058084

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058084 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058084|OTTDARG00000040457|ZDB-GENE-980526-285 ctslb|OTTDARP00000045481 DKEY-239J18.4-001 LG_ BX465840.13 Danio rerio protein_coding NOVEL, 1289 bp
AAACAAAACTTGGTTTGCTTGTGAAAGTCCTCCAGGCAGT
ATGATGTTTGCTTTGCTCGTCACGCTGTGCATAAGTGCAG
TGTTTGCTGCTTCATCTATAGACATCCAGTTAGACGACCA
CTGGAACTCCTGGAAGAGCCAGCATGGAAAAAGCTATCAT
GAGGACGTAGAGGTCGGGAGGAGAATGATTTGGGAGGAGA
ACTTGAGAAAAATTGAGCAACACAACTTTGAGTATTCCTA
TGGAAATCACACCTTTAAAATGGGAATGAATCAATTTGGT
GACATGACAAATGAGGAGTTCAGACAGGCAATGAATGGTT
ATAAGCATGACCCCAACCGGACGTCACAGGGCCCGTTGTT
CATGGAACCCAGCTTTTTTGCAGCCCCACAACAGGTTGAC
TGGAGACAGAGGGGCTTTGTTACTCCTGTCAAAGACCAGA
AACAATGTGGATCTTGCTGGTCTTTCAGTTCAACGGGTGC
CTTGGAAGGTCAGCTCTTCCGTAAAACTGGAAAGCTGATT
TCTATGAGTGAGCAAAACTTGGTGGACTGTTCCAGACCAC
AGGGCAATCAAGGGTGTAATGGAGGCCTCATGGACCAGGC
CTTTCAGTATGTTAAAGAAAACAAGGGGCTGGATTCTGAG
CAGTCATACCCTTATCTTGCAAGGGATGATCTGCCATGCC
GGTATGACCCCCGTTTTAATGTCGCTAAAATCACCGGATT
CGTGGACATCCCCAGAGGTAATGAGCTTGCCCTAATGAAT
GCTGTTGCTGCTGTGGGTCCTGTATCTGTTGCTATTGACG
CATCACATCAATCCCTACAGTTCTATCAGTCTGGCATCTA
TTATGAGAGAGCATGTAGCAGTAGTCGACTTGATCATGCA
GTCTTGGTGGTTGGCTATGGTTATCAGGGTGCTGATGTTG
CTGGGAATAGATACTGGATTGTGAAGAACAGCTGGTCTGA
CAAATGGGGTGACAAAGGCTACATCTACATGGCAAAAGAC
AAAAACAATCACTGTGGCGTTGCAACATCGGCCAGCTATC
CCCTAATGTAAGGCCACTGGAGCCTTCTCTGCATTCTGAA
AAAGACACGTTTATGGTTTCTCTATTTTAATGTGTTTTTA
TTTCTTCAATTTTATCAAATTGTTCTGCTGTTAGTGCTAT
GATAGTAGTATTTTAGGAAATTCCATTTTTCTTGTGTTTC
ATATATTCTTGTTTATGCAAGAATGAGAATTCTGTACTGG
ATCTATTTGACCTGCAAATGGAAAAATATAAAATTTTCTG
GCATGGCAA

ctslb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ctslb-201 (1) 1351
ctslb-203 1289
si:dkey-26g8.4-201 (1) 1348
si:dkey-26g8.4-202 (1) 308
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctslb-203 Contained in:

OTHER ctslb-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058084 (1)
  • Ensembl_Trans:ENSDART00000047916 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC152283 (1) 1319 bp
    CITATIONS (2)