Transcript

lrp2b-202

ID
ZDB-TSCRIPT-121213-883
Name
lrp2b-202
Previous Names
  • lrp2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058051 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058051|OTTDARG00000040441|ZDB-GENE-111115-1 lrp2b|OTTDARP00000045457 lrp2b-001 LG_none CR752646.10,CR456625.13 Danio rerio protein_coding KNOWN, 14255 bp
GATGCACTTTGAGTGGATACACGGTTGTAGTGTAGAATCA
ATCTTCTTCTATGGCCAGTTTTTTTCAACTGTTGAGTTTT
GACCAAGTCAAACAGTAATGGACCAATTAGGTCTTTATAT
TTTAGCAGTGTTATTTTTAATCCATGGACCCTACATCGTG
CAAGGTCAGTGCATGAGTGGTGAGTTCCAGTGTAGCAATG
GTCAATGCATAAATCAAGACTGGAAGTGTGATGGAACAAA
GGACTGCACGGACAACTCTGACGAACTCAACTGCCCATTA
CCCACCTGTAGCTCTCAGGAGTTCAAGTGTCTGACAGGAG
GAGAGTGCATTCCTCTTGAGTTTGTATGTGATGGAGAAGC
AGACTGCGCTGATGGCTCTGATGAGCAAAGGACCTGTAGT
GGTCAGACGTGTAGTCCAGACCAGTTCACATGTAGAGAAG
GGCAGTGTATTCCCAAACAATACAACTGTGACCATGTGCC
AGACTGTGTGGATAACTCTGATGAGAACAACTGCAATTAC
CCAGCCTGCACAGAGAAGACATGTGCTAATGGCGCTTGTT
ACAACAATGCTCAACACTGTAATGGGATACTAGATTGTCG
AGATGGATCAGATGAATCCAACTGCACAAGGCATTGTCAG
TCACATCAATTTGAATGTGCTAATGGATTCTGCATCCCAA
TGCCCTTTGTCTGTGATCACTGGGATGACTGTGGAGACAA
TAGTGATGAGCAAAACTGTGAGTATCGGACCTGTAGTGGG
TCAGAGTTCGCCTGCAGCAATGGACGCTGTATGCCACAGC
AGTGGGTGTGTGACGGCATCAACGATTGCGGTGACTTTAG
TGATGAGAATGGATGCGACCCAGGTATAAGAGATTGTTAC
CCAGGCGAATGGCCTTGCCCAGGTTCTTCACTGTGTGTGC
CGGTAAACAAAGTGTGTGACGAACATCCTGACTGCCCTGG
TGGAACAGATGAGAGCAATGCTACAGCACATCTGACCTGC
GATTTACACCAGTGTTCTGCTTTGAGCTGTGAGTACCGCT
GTCATCCCACCCCACAGGGAGGAGCATGCTACTGTCCTGA
TGGCTTCACTGTGGCCAATGATAGTCGCACTTGTGTGGAC
TATGATGACTGTAAAATTTGGGGTATCTGTGATCATTTCT
GTGAGGATCGTCCAGGCACACATCATTGCAGCTGTGCTGA
TGGATACTTCCTGGAGCAAGGTCATGTCTGCAAGGCCAAT
ATTTCAGGGGGTTTACCACAGCTGATCTTCACAGATGGAC
GTGATATCAAAATGGCAGATATACATGGGCGTTTTATCAG
ACTTCTAGTTCAGTCAGATGGTAAAGGCTATGCTGTGGGT
GTTGGTTACAACTGGCACACTCAAAGGGTCTTTTGGACAG
ACACGAGTTCTCAGAAGGTTTTCTCCATAAATTTTGATGG
GAGTGATAAGATGGAGGTGCTTTCTGAAGCAGTACACAAT
GCACAGAATGTAGCAGTAGACTGGATAAACTTTAAGCTGT
ATCTTGTTGAGGAACGTGTGGAGAGAATCGAAGCATGTGA
TTATGATGGGGGAAACCGTGTCACACTGATTGCAGAAAAC
TTGGTGACTCCTCATGGACTTGCTCTGGACCCAACCGTGG
GATACATGTTCTTCACAGACTCTGGCGATAACACAGATGA
TGTCAAATTGGAGCGAGCCTTCATGGATGGTAGTAACCGA
TTTGATCTGGTTAGGACCAGATTAGGTAGCCCTACCGGAA
TCACCTTGGATTTGGTCACCAAGAGGGTTTACTGGACAGA
CAGTCATTTTAACCTGGTTGAGACAGTCACATATAGTGGC
TTGGACAGGAAAACAGTGTTGAATGGAGGCCATCAGGTTC
CTCACCCATTCGGAATTTCAGTATTTGAGAACCATGCTTT
TTTCACTGACTGGGTCAAAATGGGTGTGATTCGGACTAAC
CGCTTCAATGGCAGTGACCCCACTTTCCTGTACCGCTCTA
CTAACCGGCCTGGACAAATTGTGGTTTCCCATCCAGCTCT
TCAGCCTTTTGTGATAAACCCGTGTGGCAGACACAACGGT
GGGTGTCAGCAAATCTGCCTTCTGAGTCACCGCACGGACA
ATGACGGGCTGGGTTATCGCTGCATGTGTCGCTTAGGATA
CGACCTTCAGGATGATCGCCACAGTTGCTTTAAAATTAAA
GATTATTTACTGGTGGCGTACGCACAAGCGGTCAGAGGGA
TTCCTCTTAATGTTTCCTCTCAGGAGGACGTCACCTTACC
TCTTTCTGGACTGGCTGATACCTTTTCTGGTTCTGGAGTA
GAGTATGATGCGTCTGTGGAGAGCGTGTTTTACAATGATC
GAATGCGGCAGCTCATATACAAATCAAACATCAATGGCAC
TAGTCATAAGGTCCTGACGGGTTACAGAGTGGGTGCTGTG
GAATCGATGGCATATGACTGGACCTCGAAGATTCTCTTCT
GGACTTCCAGCACATATCGATCTGTCTGTGCATTTAAAGT
AACAGATGGATCTCGACAGGACATTGTTAAGAACTTGATA
TACCCCCGGGGTATTGCTGTGCACCCTAGTGCTGGATACC
TGTTCTGGTCTGACTGGTACCGTCCAGCTGTGATCACCAG
AGCATACACTGATGGAAGCAATGCAGTTCCACTAATCAAC
ACAACACTTGGCTGGCCTAATGGACTTGCCGTAGACTACA
TGATGGATAGGCTGTATTGGGTTGATGCACAGCTGGATCG
GATTGAGCATGTAAGCATTGATGGGTTTGACCGACAGGCC
TTCTCCAGCATTGGACAAATCACTCACCCTTTCTCGCTTA
CGATACACACTGATCATCTATTTGTGTCAGACTGGCGGAC
AAATTCAGTTTTCCGAATGAGGAAAAGGGACGGTGGAGAC
AACATAATGCTCCGAAAGGGGATTTCGGGTATAATGAACA
TCAAGGCTTATTCAGCTGATCTCCAGGATTTATTTAAAAG
CAGATGCAATATGATTCCAAACGGACGCTGCAGCCACTTT
TGTTTTCCTACACCTGCATCCAGCCGTGTGTGTGGATGTC
CCTTTGGCATGAAGCTGCAGGAGAACCAGAGAGACTGTGT
GAAAGATGACTCTGAGCCCCCTCCAGATGATAACTGCGGA
GACTATGCCTTTCCTTGTGACGGAGGTCGCTGTGTGCCCA
ATACTTATCGATGTGATGGTGTAAACGACTGCGTTGACAA
GACTGATGAAGTCAACTGCACTCTTCCAGGTGCAACCTGC
TCCCCATATGCATTCACTTGTGGTAACAAGCACTGCATCC
CTGCTAGATGGCGCTGTGATGGGCATGATGACTGTGGCGA
TGGATCCGACGAGACTAACTGTCCAACACGTGGTCCAACC
ACCTGCTCATCTAGCCAGTTTGCTTGCACCAATGGAAACT
GCATCCCGAAAACGTGGGTCTGCGATGCCTTTAATGACTG
TGGTGATGGTTCTGATGAGAGACATTGCAATTCCAGTATC
ACCACCTGCCAGCCTGGATTCTTCCTGTGTCCAGATCACC
GCTGTATCTATAATTCATATGTCTGTGATGGAGACCAGGA
CTGTTTGGATGGCTCAGATGAGAAGGACTGTGTGTATACC
TGTGGAACATATGAGTTTGCATGTGCCAGCGGAGATCAGT
GTGTGAGTCAGAGCTACCGCTGTGATGGGGTTTATGACTG
CAAGGACCACTCAGATGAGAGTGGCTGTCCCACACGTAGG
CCAGGTCTGTGCCATGACAATGAGTTCCAGTGCCAGGTTG
ATGGATTTTGCATTCCGAAAGAGTGGGAATGTGATGGCCA
TCCGGACTGTGTGGATGGCTCTGATGAGCATAATGGCTGC
CCTCCGCGTACTTGTAGTTCTGTGCAGTTCCAGTGTGCTA
ATGGGAATTGTGTGTCCAAGAATTGGGTGTGTGATGGGGA
AAATGACTGCAGGGATATGAGCGACGAAACGAACTGCCCC
ACTCCACCATTCAGCTGCCCATCAGGTCAGTGGTTGTGTC
CTACAGACCAGGTGTGCATCATGAATGCCCAGGTGTGTGA
TGGTCAAAGAGATTGTCCAAATGGAGCTGATGAGTCTCCC
ATCTGCAATGAAGATGACTGTAAGGTGAATAATGGTGGCT
GCAGTCATGGCTGTATTCAGGGTCCATTTGGAGCTCAGTG
TACCTGTGACCCAGGATTCCAGTTGCTGAATGACTCAAAG
ACCTGCGATGACATAAATGAGTGTCTCATACCTGGATTCT
GCAGTCAAACCTGCTTCAATGAGCGTGGCTCCTTCCGCTG
CTATTGCGAAGATGGCTACCAGCTGGAACCTGATGGACGT
ACATGCAGAGCCACCAGCCCAGGAAATGCCTTACTTCTGG
TGGCCAGACGCAGTCAGATCATCGGCAACCGCATCAACTT
CTGGCCACCGATCATCAGTCCCATAGTCAGCGGCATGAGC
ATTGTTGCTGTAGACTTTGATAATGTAAATAAAAGAGTTT
ACTGGGGTGATTCATCTGACAAAATGATCTATAGTTCATT
CCAGAATGGCACAGATAAAAAGCAGGTGTTTTCTTCGGGC
CTGATGGTACCTGAAAGCATAGCCGTGGATTGGGTGGGTA
GAAACATTTACTGGACCGACTCTGTCATGCAAAACATTGA
AGTAGCAACTCTGGATGGCCACTTTCGGAAGATTCTGATT
ACAAAGAATGTCACAAGCCCTCGTGGACTGGTTCTAGACC
CCCGCAACCATACTAATTTAATGTTCTGGTCAGACTGGGG
TCAGAACCCTCGTATAGAACAGGCTAGTATGGATGGACTC
GGAAGAAGAGCAATTGTGACTAGCAAAGTATACTGGCCTA
ATGGACTTACACTGGATTACACAACTAGAAGAGTATATTT
TGTTGATGCCTACCTAAAATACATTGACTACTGTGACTAT
GATGGCAAAAACAGGCATCAAGTCTTTGCGAGTGACATAG
TGCTTCAACAACCCCATGGCATTACCATCTTCGAAGACAA
CATCTTCTGGAGTGACAGTTACACAAGCCAAATCATGAGG
ACTAATAAATTTCATGGGGGAAACATAACCACTCTTCTGA
CCGGTGTTTATCAGTGCATGGGAATTGTAATGGATCACCC
CATTAAACAGCCTATAGCATTTAATCCTTGCGAGAACAAT
CCATGCAGTCAGCTGTGTCTGCTATCAACCTTAAGACCCA
GATACTACAGATGTGACTGCCAGTCTGGCTGGATCCTTGC
CAGTGATGGTCGTACTTGCACTAAAGATGAAACACCATTC
TTGATGGTTGTCAGAGATACAGTGATTATGGGAATACCTC
TCAACCCCAATGACACATCCAACAATGCCATGGCACCAAT
TTCCGGTATTACCCAGGGTCGAGATATTGATTTTGATGAT
CGAGAGCAGTTTGTATACTGGGTGCAAGGCACAGGTGCAA
TTTATAGAAGTAAGACAGATGGGGCCAATAGAACTCAGTT
TGCACCAGCTGCCATTATTGGTTCCCCCTCTGGTCTCGCA
TTTGATTGGATAACACGAATCATGTACTACACCAATCCCA
CTATTAAGGCCATTGAGGTTATCAGGGTTGATGGATCCCA
ACATTACAGAAAGACTATCATCACAAACACTGGAAAGCCA
GAAGGAGCTGGACAGCCAATAGGAATAGCTCTTGATCCAG
CCAGGGGGAAACTTTTTTGGACAGACAGAGGTTCAGACAG
TGGAGTTCCGCCAAAGATATCAAGTGCAGACATGGATGGT
GGTAACGTCAAAAACCTCTACACTGGTAACCTGGTGAAAG
TTGAATTCATTGCTGCAGATATAGAGGCCAGGAAGATCTA
CTGGGGTGTTCATCAAACAGGAATGATTGAGTGCGGAACT
ATGGATGGGGCAAGCAGGGTGACCATTGTTAGTGGCTTGT
CTCACCCCTGGGGAATCACTGTTTACCAAAACTATCTTTA
TTATACTGACCTTGATTTTGAGGTCATTGAGAGAGTGGAC
AAGAACACGGGTGCAGATATGGTGGTGATGAGAAGCAGTA
TGGCAGGGCTGCGGTCAGTAAAAGTGCATGCCAGAGACAA
TTCTGCTGGCACTACCAACGCCTGCAGTACAAACAACGGA
GGATGTCCCCACTTGTGTCTGCCTAAACCCCAAGGACAGA
AAACATGTGCCTGCACAACAGGATTTATCCCATCTCAAGA
TGGATCTCACTGTGAGCAGTACGACTCTTACGCCATAGTA
TCATCTTCCAAATTTATAAGAGGATTCCACATCAACAGCT
CTGACCACTCTGAGGCCATGGTTCCTGTAGGGGCAAATAC
ATACTCGATTATTGACAAGCTGGACATGCACATTGCTTCT
GGATTCCTGTACTGGACTGATAACAGCACCTACTCATCAT
ACCGAGGCATTTACAGAACAAAGACGGATGGCTCACGCTA
TTCTACAGTCATCAGTCAATTGGGCAATGGAAGAATTCAG
GGCTTAGCGGTAGACTGGATTGCAGGAAACTTGTACTTCA
CTAACAAATTCACCACTCAGACATACATTGAGGTGCTACG
TTTGAACACAAGCATTCAACTGATCCTCCTGAAAAGTTCA
GCAGATCGTCCCCAAGATCTTGCTGTGAGCCCCAAGTTAC
GTCTTCTCTTCTGGACTGATGCTGGTCAGTCCCCTAAGAT
TGAAAGTGCTCTTTTGGATGGTACCAATCGCACAGTTCTT
GCTTCTGAGAGCCTTTCATCCCCCCGAGGCCTTACAATTG
ATTACACCAATGACTTTCTGTACTGGGTTGATGACACACT
GGATATGATTTCTCGAATGGCTCCTGATGGTTCTCAACGG
GAGATTGTACGCTTCGGTAGTCGGTACCCTGCACCATATA
GTGTGGCAATCTTTGGCGAGTACATGCTGTGGGTGGATCG
CAAACTGGGCAAACTCTTCCAGGCCAGTAAGGTACCTGGG
AATACAGATACACCTGAGGTGATAAGAGATGGCATTGATG
ATCTGACAGATGTTGCAGTGTTTGACTCACATGTTCAGCC
CACTTCTGCCAACCTGGTGGGTTTCAACCCTTGCCATGAT
GACAATGGGCGTTGTCAACAGTTTTGTTTTGCATTGCCCG
ACCAGCAGGAGCCCAAATGTGCCTGTGCCCATGGCTCTCT
GCTGAGCAATGGAGTCTCATGTGGCTTTGGCCTGGATGAG
TACCTGATCTTCACAACAGATTATAGTGTGAGCAGCATGA
GACTGGACCCGGAGGACCACAGTGTCCCATTTCCCACCTT
TAACATGGGTTATGGTGTTTTAGCCATAGAGTTTGACTTC
CAGGATAAAAGAGTGTTCTTCACTCAGTACGTGGGGCTGG
GCAGGAGTAAAATAGGATACATCATAACCACCAGCAGCAC
TAGCCCACCAGTCACCATTGCCAGTGATCTTGATGATCCT
GAAGGTCTGGCCTATGATTGGGTCCACAAGCGTCTTTATT
TCACAGATTATTACAATCGTAGTGTGCAGTCTATGGGAAT
AGATGGCCAAAACCGTTCTTTAATTGCACATGGTGACCGT
CCCAGAGCTATTGTAGTGGATCCATGTTATGGATACCTGT
ACTGGACTGACTGGGGATCCCCTGCTAAAATTGAACGGGC
CACACTTGGTGGAAACTTCCGAATCCCTGTCATAAACACA
AGTCTTTCTCAGCCTAATGCTCTGTCTTTGGATTATGAAG
AGCGACTTCTGTACTGGGCTGATTCAACACTGGATAAGAT
TGAACGTTCTTCTTTGACTGGAGAAAACAGGGAGGTCATT
CTTACCCAGACACAGTACCCATTTGCTCTGACAGTATTTC
AGCAGGATATTTATTGGACTGACTGGAACACAAGGATTGT
GTACCGTGCCAGCAAGGATGATGGTTCTGGCCTAACTATA
ATGGCCACTGATCTCCAATATAGACCCAATGACATTCACG
TCTTCTCTGCCAGTAGGCAAGAAAGCTGCTCAAGTCCCTG
CCAGCTGTTCAATGGAGGCTGCAGCCATGTTTGTGTCCCA
GGTCCAGCTGGTCCAGAGTGTCAGTGTCCCAGCACTGGTA
ACTGGTATCTGGCCAACGAAGGGAAAGACTGCATCCCTGA
CAATGGGCAACGTTGTCATGCAGATCAGTTCACCTGTCTG
GATGGAAGATGTTTGTCTCAGAATTTCAAGTGTGATGGCT
ACAGGGACTGCCTTGATGGGTCTGATGAGCTTGAACGAGT
TTGTGCTTTTCACACCTGTTCACCAACTGAATTCACCTGC
GATAATGGAGGCTGTGTGCCTCTGTACTATGTGTGCGACT
ACACTAATGACTGTGGAGATAACAGCGACGAGCATGGTTG
TCCCTTCCCTACTTGTAACCCTTCCACAGAATTCACCTGT
GCTAACGGACGCTGCATCAGTGCAGCTTACGTGTGTGATG
GGATCAATGACTGCCGAGACAATGGCACCACAGATGAAGT
TAACTGCCCGGATCGAACCTGTGCACCTGGCTTAGTGAAA
TGTGACACCACCAACATCTGCATTCCTTCGAGCAGCCTGT
GTGATGGCCATAACAACTGTGGGGATAACAGTGATGAAAA
TCCACTCTTTTGTGCTGGACGAACGTGCTCTGCAGATGAG
TTCCGCTGTGATAGTGGGAAGTGTATTCCCCAGTTTTGGG
TGTGTGATCGCATCTCAGATTGTTTGGATGGCACAGATGA
GCCTCCCACTTGCGAGGATCACATTTATACTTGTAGCCCT
CAGCAGTTCAACTGCGCGAATGGAAACTGTATTCAGCAAT
CATGGGTATGTGATGGCAACAATGACTGTGGAGACAACAG
TGATGAGGCCCAGGAGCTGCAGTGTGGATCAAGGACTTGC
AACCCTGGTGATTTCACATGCCCCAGTTGGTACCCTGGCT
CTCCTCGCTGTATTCCGTTAAGTTATGTTTGTGATGGTGA
GAAGGACTGTGTAGATGCTGCAGATGAGCTGCACAACTGC
CCCAACCGCACATGCCACTTAAATGAGTTTGCTTGTGCCA
ATGGTCGCTGCATTCTGCTGCCCTTCCACTGTGACCGTGT
GAATGACTGTGGGGATGGCAGTGATGAGACCAACTGTATT
TACAACACCTGTTCCAGTCGGGAATTCACCTGCCAGAATG
GAGTTTGTATCCCATCAACGTATGTATGTGATGGTTATAT
AGACTGTCAAGATGGCTCTGACGAACTAGAGGGCTTGTGC
AGGACTCCTGAACCCACCTGTGCACCTGGAGATTTCATGT
GCAATTCTGGGGAGTGCATTGACATCCACAAGGTTTGCAA
CCAGCAAAGAGACTGTTCTGACAATAGTGATGAGAAAGGT
TGTGGTATAAATGAGTGCACTAACCCAGCCATTCACCAGT
GTGCACATAACTGCATAGACACTCAGACTGGTTACTACTG
CTCCTGCAGAGAAGGCTACAGACTAATGCCAGACGGCAAA
GCCTGTGAGGATATAGACGAGTGCAAGGAGGTACCGGGAG
TGTGCAGTCAAGTGTGTGAAAATGCTGTGGGCTCCTTCTA
CTGCAAGTGTGCTCCGGGATACCTGCGGGAGCCAGATGGA
CGTACTTGCCGACAAAACAGTGGGATCGCCCCTTACCTTC
TCTACAGCAACCGTTACTATATCCGCAATCTGACTGCTGT
TGGATCATCAATGTCAGTGGTGCTGCAAGGCCTGACAAAT
GTTGTTGCACTGGATTTTGACACAACTGAGAAGCGTTTAT
ACTGGGTGGATGTTGGCACACTCCGTATTGAGAGAATTAA
TTTAGATGGCACAGGAAGGGAGGTCATAATGCAAAATGAC
CTGGGTGGAGCAGAAGGCCTGGCAGTGGACTGGGTGGGAC
GAAAGCTGTATTGGGCAGATGCGACTATGAAAGCCATTCA
TGTCTCTGAACTTGATGGACGTTACCGGAAAAAACTCCTA
AAAGACTGTGTTGATACCAACTCCACATACTGCTTTGCCA
GTCCTCAGGCGGTTGCTGTTAACCCTAAATATGGATGGCT
ATATTGGACAGATTGGGGGAGGAAGGCTTTCATTGGCAGA
GCTGGCATGGATGGAACCCAAGCATCAGCTCTCATCACCA
CAAAGCTAGTGTGGCCGCATGCCCTGACCATCGATTATAC
CAACAACAAAATATTTTTTGCTGATGCTCACCTTAATTTC
CTTGATTATGCTGATATGGATGGTCAAAACAGACACAGAG
CTATAACAGGCTCCTTGCCCCATGCTTACGCTCTGACTCT
GTTTGAGGATTTGGTGTACTGGACTGACTGGAATACCCAC
ACCATAGAGCGAGCTCACAAGTACACAGGCGCTAACCGTG
TTGTAATGGGCAACAACACACATCGCCCTAATGACATTCA
TATCTATCACCCTTACAGACAGCCACACAGTGAAAATCCA
TGCAATGACCATTACCTGACCTGTAGTCACCTGTGTCTGA
TTGGTCCGGGTGGGACGGAGGCCAGATGTGAATGTCCGGA
CCACTTCATTGGTCTGGCTATCGGATTTAAGATTCAGTGT
GTGGCCGACTGCTCCAGCACTCAGTTCCGCTGTGGAGACA
ATGAGAAGTGCATTCCTATATGGTGGAAGTGTGATGGCCA
GTCAGATTGTGGTGATGGCTCTGATGAGCCTCAGACGTGT
CCTCCACATTACTGCAAAACTGGGCAGTTTCAGTGCCAGG
ATGGGAACTGCACTAACCCATTTTTCCTATGTGATGGCCA
CAAGGATTGCTTTGATGGATCTGATGAAGACGCTGCACTT
TGCAGTGACCACCGTTGCACTGAGAACCAGTTCCAGTGTA
AAAATAAGCATTGTATTCCCATAACTTGGCACTGTGATGG
TGTGGTGGACTGTTCAGATGGCAGTGATGAGGAAACGGAC
AGTTGCATAGACAAGACCTGTAAACCTGGACAGTTTCAAT
GCAAAAAAGGAGGCTGCATACCACAAAGTTATGTGTGTGA
TGCACAGAACGACTGTGGAGATAATTCAGATGAGCCATAT
GAAGTGTGCATGGGTCCTGACTATAAGTGTGATCCAGACA
CCGAGTTCCCCTGCAAAGGAAACTATCGTTGTATACCTCT
ATGGGCTGTGTGTGATGGCACCAATGATTGTCTAGACAAC
AGTGATGAGAACACCTGTCATGAGCTAACCTGTGACCCTC
TGGGAGATTTTCGCTGTGATAACCATCGATGTGTACCCAT
CCGCTGGCGCTGTGATGGGAGCAATGACTGTGGCGATGGA
TCTGACGAGAGAAACTGTGAACCCAGACCTTGCTCTGAAA
GTGAGTATCGGTGTGACAACCAGCAGTGCATTCCAGGAGC
TTGGGTTTGTGATCATGACAATGACTGCGGAGATAATTCT
GATGAGAGAGACTGCGAACTACGAACATGTCGTCCTGGAA
CATTCCAGTGTACGTCTGGACACTGTATCCCAGAAGCTCT
TAAATGCAATGGTTATGCTGACTGCCTGGACTTCTCTGAT
GAGTCCACCTGCCCCACTCGCTATCCTGGAGGACGCTGGT
GTCCAGCACACCAGTTTCAGTGCAACAACAAGTTGTGCGT
GAATCAGCAATGGGTGTGTGATGGCTTCAATGACTGTGGA
GACCGCTCTGATGAGCAGCTCAGTCTCTGTTGGAACATTA
CATGTGAAATGCCTACCAAGTTCCGCTGTGATAATGGCTA
CTGCATTTATAGTGGTCTCATGTGTAATCAGAAAGACGAC
TGTGGTGATGGCAGTGATGAAAAAGAGGACCAATGCCAAG
AACCCACTCTCGCCCCCTGCACACCAAATGAGTTTAAATG
CTCAAATGGCCACTGTGTTCCTCTGCCTTACGTGTGCGAC
CACAATAACAACTGTGGAGACCTAACTGATGAGCTGGGCT
GCAATTTTGGCCATGATCGCAACTGTGATGAGAAGTTATG
CAAGCATGAGTGTACAAACCTGAATGGCACTGGCTTTATC
TGTTCTTGTCGTCCTGGCTATGCAGTAGATCCTGATAACA
CCTTTCTTTGCAACGATATAGATGAGTGTTTAGAATATGG
CACATGCCCACAAGCCTGCATGAACACTAAAGGAAGCTAT
CACTGTGATTGTGCCCAGGGCTACAGGAAAGCTGGCACAG
GCAATCAGTGTGAGGCCGAAGGTCCTGGACCACTGCTTCT
GTTGCCAGAGAACATTCGCATTCGCCGATACAATCTTCAG
ACAGAGGAGTATCATGACTTCTTGCAGGAAGAGGAGCGCA
TTGTGGCACTGGACTACGACTGGGACCACAACAACACTGG
ATTTAGTGTGGTGTATTTTACAGTAGAAGGGAGGGGTGCA
TTGCCTGGTGCTATTAAAAGAGCTTTTCTGCCAGATGTGG
ATGATCATAATAATAACATTGCTGCAGCTGTGGAGCTGGA
TATAAAGTACATCACTAAGCCTTATGGAATTGCAGTGGAC
TGGGTTGGCAGGAATTTGTATTGGGCTGATGCACAGCTGA
AGCGTCTAGAAGTGGCCATGTTAGATGGCCGTTACAGGAA
GCACCTGATTAAAACTGACCTGGAAGCACCTAATTCTGTG
GCATTGAACCCTCGCTTGGGCATGCTTTACTGGATTGACA
ATGGAAACACACCTCGTATTGAATGCTCCTGGTTGGATGG
TCAAGAGAGAAAGGTTCTGGTAAACAATGGTTTGGGATGG
CCAACGGGCCTGTCGATTGACTTCACAAATGGTGACCGGA
TTTATTGGTCAGATGCAAAAGAGAGTCGCATTGAGTCCAT
CCTGCCAGATGGACAGAACAGAAAGACATCGGTTTTCATA
GATGTAAGAAACCCTTTCAGTGTGAATGTATTTGAAGACC
ATGTGTACTGGAGCACACAGGAAAAGGGTGAAGTGTTCAG
ACAGGACAAGTTTGGCAAAGGCACCAAAACCAGACTCCTT
GTAACAGGACCTTGGCTCACCCAAATCAACATATACCAGC
AGCAGAAATACAACTCTATAGCCCTGAAGAACCCTTGCAA
GGGCACATGCAGTCACCTGTGTCTGCTGAGACCAGGAGGA
TACACCTGTGCCTGTCCAGAGGGCACCAGCTTCTTTCCTG
GCAGCAGTACTGCTTGTGACGCAGGGATTGATCCTGAACC
GACCATGCCCCCTCCATGCCAGTGCAAGAATGGTGGAACC
TGTTATTTTGATGACAACAAGGCGCTCTGCATTTGCCCCT
CTGAATGGAAAGGAGATTTCTGCGAGACAAGCGTTTATGG
TGTAGTCACAACTTCAGTTGCGATTGCTCTTGGAGTTACA
GCTGTTGTGGCTCTTTTCCTGGGCTGCCTGATATATTCTG
CACATAAGAAGGAGAACATCAAAAACAGACTGAATAACAT
TAATCTGCCAGTTAATGTATCTAACTTTATGCCCACTTTC
TGGCGTGGTAACTCTGAACGTTTTAGCAACTCACCTGAAT
CTGAGAATGACAGCAATAGCCTTCCCAAAGAGGAATCCAG
CACGTCAGTGGAAGTGGAGAAAATAGGAAGGAACTTTGAA
AACCCAGCATACGCTGACGATACACAAAGCTGTCCTGCTG
CCTCAACTGCTACAGCCACCTCAGTCATAAACGGACCTGC
CAAAGAGAGTGTTGAAAATCCGCTCTATGCTGCTGAGATA
AGCGTTGTGACCCAGCCACATGATGCTGCAACCCCTGTCA
AAGCAGATGCCACACCAGTCAACACTGAGTCTCAAAAGGC
TGATACATCAAAGCTACAGAGTGAGGTGGATATCGATAAT
GTGTTCGACAACCCATTATATATGGATGAACCACACATAC
AGAGCAATGGAGAATCTACGATCTGAAGATAAATTGAGAG
CATCTTATAGGATTTGCTCTCAGCCTGTTCGACAGCTAAG
ATGTGTGGCTGGTGAATTATGACTGCGGTACACCATCCAT
CTGCTCACATGTGATTTGTGTCTGTTTTACAGGGAGTTCT
AGCTGAGAACCACACTATAAACTGTGAATACTTCTGATGA
TTGCTCTTTTAAGTATATTTTATTTAGGGAATGCTTTGTT
TTGTAATAATTCAGAGGCTGTAAATTGATGCAGTGGTTTT
ATTTAATTATTGTGGTATCTTTGTGTAGCTTGTATGATCA
GATACAATGTTTCTTGGTTGTGTTTTGATACCAATAAAAT
GTATTTATGTCTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations