header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-273
Transcript Name: si:dkey-26g8.4-201
Previous Names: dkey-269i1.1-001, ottdart00000058085

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058085 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058085|OTTDARG00000040458|ZDB-GENE-980526-285 ctslb|OTTDARP00000045482 DKEY-269I1.1-001 LG_ BX322603.16 Danio rerio protein_coding NOVEL, 1348 bp
GCAGTCAGTAAGGTTTGCTTGTGAAAGTCCTTCAGGCAGG
ATGATGTTTGCTTTGCTCGTCACGCTGTGCATAAGTGCAG
TGTTTGCTGCTTCATCTATAGACATCCAGTTAGACGACCA
CTGGAACTCCTGGAAGAGCCAGCATGGAAAAAGCTATCAT
GAGGACGTAGAGGTCGGGAGGAGAATGATTTGGGAGGAGA
ACTTGAGAAAAATTGAGCAACACAACTTTGAGTATTCCTA
TGGAAATCACACCTTTAAAATGGGAATGAATCAATTTGGT
GACATGACAAATGAGGAGTTCAGACAGGCAATGAATGGTT
ATAAGCATGACCCCAACCGGACGTCACAGGGCCCGTTGTT
CATGGAACCCAGCTTTTTTGCAGCCCCACAACAGGTTGAC
TGGAGACAGAGGGGCTATGTTACTCCTGTCAAAGACCAGA
AACAATGTGGATCTTGCTGGTCTTTCAGTTCAACGGGTGC
CTTGGAAGGTCAGCTCTTCCGTAAAACTGGAAAGCTGATT
TCTATGAGTGAGCAAAACTTGGTGGACTGTTCCAGACCAC
AGGGCAATCAAGGGTGTAATGGAGGCATCATGGACCAGGC
CTTCCAGTATGTTAAAGAAAACAAGGGGCTGGATTCTGAG
CAGTCATACCCTTATCTTGCAAGGGATGATCTGCCATGCC
GGTATGACCCCCGTTTTAATGTCGCTAAAATCACCGGATT
CGTGGACATCCCCAGAGGTAATGAGCTTGCCCTAATGAAT
GCTGTTGCTGCTGTGGGTCCTGTATCTGTTGCTATTGACG
CATCACATCAATCCCTACAGTTCTATCAGTCTGGCATCTA
TTATGAGAGAGCATGTACCAGTCGACTTGATCATGCAGTC
TTGGTGGTTGGCTATGGTTATCAGGGTGCTGATGTTGCTG
GGAATAGATACTGGATTGTGAAGAACAGCTGGTCTGACAA
ATGGGGTGACAAAGGCTACATCTACATGGCAAAAGACAAA
AACAATCACTGTGGCATTGCGACAATGGCCAGCTATCCCC
TAATGTAAGGCCACTGGAGCCTTCTCTGCATTCTGAAAAA
GTCACGTTTATGGTTTCTCTATTTTAATGTTTTTATTTCT
TCTATTTTATCAAGTTGTTCTGCTGTTAGCGCTATGATAG
TAGTATTTTAGGAAATTCCATTTTTCTTGTGTTTCATATA
TTTTTGTTTATCCAAGAATTTTGTACTGGATCTATTTGAC
CTGCAAATGGATAAATATTAAATATTCTGGCATGGCAATC
TCAAGTCTGTACTGTGTTTATTTGCACTTCATGTAGAAAT
GCCATAAATATTAAATGTTTTAAAAGTG

ctslb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ctslb-201 (1) 1351
ctslb-203 (1) 1289
si:dkey-26g8.4-201 1348
si:dkey-26g8.4-202 (1) 308
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-26g8.4-201 Contained in:
[BAC] DKEY-269I1 (1) (order this)

OTHER si:dkey-26g8.4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058085 (1)
  • Ensembl_Trans:ENSDART00000152154 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT655132 (1) 797 bp
    GenBank:EB787133 (1) 440 bp
    CITATIONS (2)