Transcript

klf7a-201

ID
ZDB-TSCRIPT-121213-24
Name
klf7a-201
Previous Names
  • klf7-001
  • klf7a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045722 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045722|OTTDARG00000032690|ZDB-GENE-050522-276 klf7a|OTTDARP00000036086 klf7-001 LG_none CU914146.10,CU571320.9 Danio rerio protein_coding KNOWN, 2960 bp
ACAGTAACCTGTGAGCTACCGCGCTCCTGCTGCTCACCTT
CTGAGGGAAGAAAACAAACCTGGATGGATGGATCCGTTAC
TTTCAAATACATTTTAGTGTCCATAGTGAAGTGAAACGTT
TCGGGTTTCGTGCTTGATCTGAATGTTTCAGTCGCTCGCG
CTGAAGCGTACGCGGATTCCTCGCGCAGAGAATCAAAGTC
TCTCAAACGCAACGTTTAGCTCCACAAACATGGATGTTCT
GGCCAATTACAGTATTTTTCAAGAACTTCAACTTGTTCAT
GACACTGGCTACTTCTCCGCGATGCCGTCTCTGGAGGAAA
ACTGGCAGCAGACATGCCTGGAGCTGGAGCGCTACCTGCA
GACAGAACCCAAGCGTCTGTCTGACCTTTTCGACGAGGAG
CTGGACGGCCTCCTCAGCCCCTCCTTCATGAAGGAAGACG
GAGACGAAGACCTGTTAGACCCTCTCCTTCCCAGCCTCAA
CAACCCTCCCAGCCCTTCTCAGCGTAAAGAAACCCACTCC
TCCATTTCTCCAGATGCCACCTTAGGAGTCAACGCTGCCC
AGCTGAATGCCGTCACATCACTAACACCGCCCTCATCTCC
AGAACTGGGTCGACATTTAGTCAAACCCACCCATACGCTC
AGTGCATCACCCGACGGGACCCTCACGCTCAAGCTTGTGG
CCCGAAAGGTGGGCTTGAGCTCTGCCAAGCTTGTGGCGGC
TCACCCGGTGCCACTTTCGCCTCAGCATGGTAGCACTGGC
ACTCAGAGCGATGGGGAACAGGGTGGCACCTGTACTATTG
GAGTCGGCGATATGGCGGAGAATAAAAAGAGGGTCCATCG
CTGCCAGTTCAACGGCTGTCGGAAGGTCTACACTAAGAGT
TCGCATCTGAAGGCACATCAGAGGACACATACAGGGGAGA
AGCCGTACAAGTGCTCATGGGAAGGCTGTGAATGGCGGTT
CGCAAGAAGTGACGAGTTGACGAGGCACTACCGCAAACAC
ACCGGCGCCAAGCCTTTTAAGTGCAATCACTGCGACAGGT
GTTTCTCTCGATCCGATCACTTGGCACTGCACATGAAGAG
GCACGTCTGAGGAGGAAGAGGAGGAGGCGGGAGGAAGAGA
CAGAGAGAAGGCCGAGGGAGAGAAAGAGGGGGATTATGGG
AAAGAGCCGAATACCACTCAGGCCGTTGGCTCATCCCACT
GGAGGGAGACCCCGGTGTGGAAACAACCAGCAAGAGCTGA
ACTTACACCAGGTCTTGAGGTTTGATCGGCGAGATGCAAG
TCACATCTGACCATGAGGATGTACATTCTGCGGTCTACAG
ATCTGAGAAGGTGTTATGACAGCTCATGTCAATGTGCTTC
AGTTGGTACTCACAACATCAATGACTTGATTTAGTTACGA
ATAATGCGCTCTCCAAGACCCATTAAAGATTTTGCCAATG
TTACTTAGACATCTTGCGCATATTGTCACAGACAAAAGCT
ATTGTTGCTCCAGATTTAATTTGCTGCACCGTGCAGGACG
TGAATGCATCTCCTTTGGAGAATATCGTAGCGATAGGACG
TCAATCCAAAGAGATGGATTTTTGTTTGTTTGTTTCATTT
TGAGCAAGGATTATCCTTCTGCTTTGATCCCGCCAAGATC
TAAAGTGGAATGTCCATCTGGAGAAATCTGGATTTCAAAA
GGCGACCAAGATGAATCGCTTTTATATGTGTATTTGACCG
GAGGAGTGAAAGAAACGCTCTTACCTTCTTCATAGATGGA
CAAATCTCTCTCTTTCACATCCCTCCCTGCCAACTAACCA
ACCAACCGCTGCGCAGCGACACTTTGAGACTTTTTATAAA
GAAAAAAAAATCAAGGAAGAGATCTTTTTGAATGATGACT
ATGTTATATAATTCAGAAGACTTCTTTTTTTGCTTTTCTC
CTGTGGATGTGTACAAAATAGAAAAAGAAACAAAAATGGA
CCAAAAAAGAAAGAAAAACTGCCATATGCACAAGCGAAAA
GTAGTGGATTCTACACTGGCACAGACCGCATCTGAGGTGG
ACTTCATTTCTTTAGAAACGCAAACTTTTAGTGGCAAAAA
AGAAAAAAAGAAAAAAGCAATGTTGTTGTTGCACACGTTT
TGAGCATTCCTCAACATTATTTATAACCCATGAAATGTTC
CCCCATAAACTTGGGTTTCTTCGGGATTTCTAGGACTAGC
ATGAAATGAGAAAAGCACCATGGTTTATCTGCGGACTTCA
CAACAAAATAATGACTTCCACCATTCAAGGCAAGATTTGC
GATCAGAAAAGTTTAGGTTGTGTAGTACGTCCCGAAAAAC
TGTCCGGACAGACACTTCCCATCTGTTATTTTAGTTTGGA
TGGTACAAAGCATCATAAATTGAAAAAAAAAAATAGTGTG
CGTTTTGTGTTTCGCTGGTCCTATAGGTGGCATCTACATG
TTTAGGCTTTGTAATGGGCTTTTTCTTACACATTACATAT
CTGTCTGCTTAGTGTTCCCGGTAAAAACAACTGTACAGTG
TGAAAAAAAAAATGTATAGTAAAAGTGAGGTTTAAATTAC
AGCGTACAATCAAGTGTGGGATGTGAATGTAAGGTTGGAT
GATTGTGGACGGCCCTGCACTTATGCAATCATTGCTCACG
ATAGATCCTACTGTGGCTCATGCATAAAGATCTACACAAA
GGCTCGTTGATGAAGGAATAACGCACATAAAATGAACAAT
CTGCCATTGTTTACTCACCCTCGTGTCGCTCCAAACCTTC
TTTCTTCAGTGCAAGACAAAAGACGTTTTGAAGAATGATG
TCTCTTTTTTTCCTACAATCAAAAACAATGGGGGATTTCA
AAGTCTGACAATTGGCATTAAAGCACTAAGATAAAGTAAA
TGTGAAAATATTCCAAATTTAACTTCATTTTAACGTCCAC
ATATTCAAACTTGACACAATTCCAAAAAATACACAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations