Transcript

pimr46-201

ID
ZDB-TSCRIPT-121213-202
Name
pimr46-201
Previous Names
  • pimr46-001
  • dkey-101n15.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057698 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057698|OTTDARG00000040202|ZDB-GENE-121214-74 pimr46|OTTDARP00000045203 DKEY-101N15.3-001 LG_ CR456631.7 Danio rerio protein_coding NOVEL, 1194 bp
ATTATTTCTCAGGACAGTTCTTTTGTTGTGCTTTTGTATT
TTTATGGTTTAATTTGTGCTCTTTTTATTTTCCATTTTAT
TATTTATTCATTTATTTTATTTAAATATTTATTTCTTTTT
GTTTATTTTTCTTTAAGTTGGAGTTTGAGGCTGTTCATGG
CGGAGATGGGTGAAAGACGAGGCCGCTCCAGATCCAGGAG
TGCTGCTTTCACTCAGACAGCAGCTCTGGACATAGGCACA
CATGATGGCACCGCTGAGCTTCCTAGTCATTTGGCTCCTC
TGCCTTCCCAGTTGGCTGAGTCTGTCTCCACCGACCAGAG
AAATAAGAAGAGGAAGTGGCAGAGCGACAGCCAGCAAATG
CAGTCCACCTCGTCCAGGAGACCGGCCAAGCGCTCTCGCA
GAGACTTGTATATGAAGGGCCCCTTGCTGGGACGCGGTGG
ATTCGGCTCAGTGTTTGCTGGGATCCGCAGGTCTGATGGA
CTGCCAGTGGCCATCAAGTACGTGTGTAAGGACCGGACGC
AGAGGAGACTGAAAGTTGAAGGTCAGGGTCAGCTGCCGCT
AGAGGTGGCCTTGATGACCCGCGTCACTTCAGCTCCTGCT
TGCCCCAGTGTCCTGCAGCTGCTGGACTGGTTTGACCGTC
CCAGACGCTACGTCCTGATCCTGGAGCGTCCGGCTCCATG
CCAAGATCTCCAGAGTTTCTGTGAGGAGAACGGCTGTCTG
GACGAGCGTCTAGCCAAAAAAGTGCTGGTGCAGTTGATCG
CGGCGTTGAAACACTGCGAGAGCCGCGGCGTCCTGCACCG
GGACGTCAAACCAGAGAACCTGCTGATCTCCACAGATTGC
CAGGACATCAAGCTGCTGGACTTCGGCTGTGGAGATCTGC
TGAAGCGTTCGGCCTACAAATACTTTGCAGGCACTCCTGC
ATACGCTCCTCCTGAGTGGTTTAGCAGACAGCGCTATAAT
GCCACTCCAGCTACAGTGTGGTCAGTAGGAGTGACCCTCT
ACAACATCCTGTGTGACCGTTTCCCCTTCAGAGGCGCACA
GAGGGTCAAGTCCAGAAGCACACTGCACTTTACTAGAAAT
CTGTCAACAGAGTGCCGTCAGCTGATTGGCTGGTGTCTCA
GTGCATCGCCAGCTGATCGGCCCACTTTAGATGACATTGA
GCGCCATGCCTGGTTGCACTGCACAGGTGGCTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations