Transcript

gdf10b-201

ID
ZDB-TSCRIPT-121213-154
Name
gdf10b-201
Previous Names
  • gdf10b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057332 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057332|OTTDARG00000039965|ZDB-GENE-120316-1 gdf10b|OTTDARP00000044933 gdf10b-001 LG_ CR450691.13 Danio rerio protein_coding KNOWN, 1362 bp
CCAACCGCTCCACATCACTCGCACACACTCATTCGCCTGC
GTTGGCTTTTAAAGGAGAGTTTGCATTCATTTTGCGAAGG
ATAACCCGTGAATATGGCATCGGTTTGTGCGGTGGCGCGC
GTTTTGCTCTGTTTGAACGTCGTCAAAGTTTACTTGGTGA
GCTCGGAGCTGAACGGAGATATTCCCGCAGAAGAGCCCAC
CATCCACAGCCCTGCTCGAGATATGATGACGGTTCATATG
TACAGAGTTTATGATAAATACAGCAAGAAGCAGCAGCAGC
ATCAACAGCAACTCAATGTGAACACAATACGAAGCTTTAG
AGGAGTTCCAGAGCTCTCCCATCACAAGGTGGTGTTCCAC
TTCAACCTGACCTCCGTTCCCGATTCGGAGATGATACTGA
CGTCAAATCTGCATTATCCTGACCAACAATCTCGCCCTCG
TTCTTGGGCCTGCCAGCGTTCCCGAAGATCCTCCTGCCGC
CTTCAATACCTTCAAACAACCACTCCACGTCTAATCATCA
AAGCATCATCAGCCAACGCCGCCGTCCCAACTCAACTCAG
CAACATCACATTACCGCCAAACAGAAAAACACTTTGGCAG
ACTGCAGATGTATCCTCAGCTATGAAGCAAGCTCATGCGA
ACGCCGAGCTCTTAATCAGTATTGAGTTTGACTTTGGTCA
CCACAAACGACAAGAGCATTTACCTCCTCACAACATGCCG
TTCATTCTTGTGTACGCTGACGATATTGATATTACAGAAC
CGAATAGTGTTGCTGGAAGTCTTCAGAGATACAGTCCATC
TCCTGTTGACAGCAAAGCATCTCCCTTAACATCCAGAATC
AGGAGAGAAGTCGGTCATTTAAAGGAGAATCAGGTTCCTG
GTGTGCGGTACATTGATCTTAAGAGCGGGGGGTTATGGGA
TGGAGCGTTTTTTGCGAAACAAAACAAACCCTTGACTGAC
ATTGAAGGCTCGAGGGGGTCTCAGGAGCTCACTTTCGATG
AGAAGACCATGAAAAAAGCGAGACGCAAGCAGTGGAGCGA
GCCGAGAGTATGCACACGGCGATATCTGAGGGTGGACTTT
GCTGATATCGGTTGGAGTGAATGGATATTAGCTCCAAAAG
CTTTTGACGCCTACTACTGTGCGGGAACATGTGCATTCCC
TATTCCAAAGGTTGTCCATCCATCCAATCATGCGACCATC
CAGAGTATAGTGAGAGCGGTTGGGATTGTTCCTGGAGTCC
CGGATCCGTGCTGCGTCCCGGATAAGATGAGCTCTCTGGC
CGTACTCTTCCTGGACTCCAGCAGGAATATGCTATTGAAG
ATCTATCCCAGCATGTCTGTGGAAACCTGCGCCTGTCGAT
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations