Transcript

map2k4b-201

ID
ZDB-TSCRIPT-121213-129
Name
map2k4b-201
Previous Names
  • map2k4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057157 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057157|OTTDARG00000039852|ZDB-GENE-080721-13 map2k4b|OTTDARP00000044820 map2k4b-001 LG_ FP017228.4 Danio rerio protein_coding KNOWN, 1578 bp
CGCACCGCTGCTTATCGGGAGTTCTGGCGCACCTGGCAAC
CTCCGCGACTCCTCCAGAAACTGCTGTCCGCCTCTGAAGC
GTCGATCACCGCGGGCGGATGGGGAGCGCACCGCTGCTCC
GGCCGTTCCAGTAGAGTCGCGTGTGCGTCAGAAACAGTGG
CGGAGAATCGAGCGCGTGAAGGCGGACTCCGCAGATCCAC
AATGGCGGCTCCCAGCAGTGACTCTGGCTCTTCGTGCGGT
GGCGGCGGTACTGCGGGACCAGCGGGACTCTCACCGCGAC
TCGGCTCCATCGGTGCTCAGGATTCAAACTCCTGCTGGCG
CTGTCAGAATGAAACAGGGTTTCAGATCAATCTGTCTGGA
GTAACCCAAATCAAACGCAAAGCGCTGAAGCTGAACTTTG
CCAATCCGCCAGTGAAGCCGGCGGCGCGTCTGCCCATCAC
CAGCACTGCACCGGCCTTCCAGAACCCACACATAGAGCGG
TTGCGGACACACAGCATCGAGTCTTCAGGCAAACTGAAGA
TTTCTCCAGAACAGCATTGTGATTTCACGGCCGAGGACCT
CAAGGATCTGGGGGAGATCGGGAGAGGAGCGTACGGATCC
GTCAACAACATGGTGCACAAACCCAGCGGGCAGATCATGG
CTGTCAAGAGGATTCGCTCCACGGTGGATGAGAAAGAGCA
GAAGCAGCTGCTGATGGATCTGGACGTGGTGATGAGGAGC
TCCGACTGCCCATACATCGTACAGTTCTACGGCGCTCTCT
TCAGAGAGGGCGACTGCTGGATCTGTATGGAGCTCATGGC
TACCTCCCTCGACAAGTTCTACAAATATGTATATTGTGCG
TCAGATGACGTCATTCCAGAGGAAATATTAGGCAAAATTA
CATTAGCAACTGTGAAAGCACTGAATCACTTGAAGGAAAA
CTTGAAAATAATCCACAGAGACATCAAGCCCTCCAATATT
CTCCTGGACAGAAACGGCAACATTAAGCTGTGTGATTTCG
GCATCAGCGGGCAGCTGGTGGACTCCATCGCCAAGACCAG
AGACGCCGGCTGCAGACCCTACATGGCTCCTGAACGCATC
GACCCCAGCGCCTCCAGACAGGGCTACGATGTGCGCTCAG
ACGTCTGGAGTTTGGGAATCACACTGTATGAGCTGGCCAC
GGGCCGCTTCCCGTACCCGCGCTGGAACAGTGTGTTTGAT
CAGCTGACGCAGGTGGTGAAGGGGGAGCCGCCGCAGCTCT
GCAGCTCTGAGGACCGACAGTTCTCACACAAGTTCATCCA
GTTCGTCAACCTATGCCTTACGAAGGACGAGTCAAAGAGG
CCAAAGTACAGAGAGCTGCTGAAGCATCCGTTTATCCTGA
TGTACGAGGAGCGTCTGGTGGACGTGGCCCGATACGTGTG
CCGGATCCTGGACCAGATGCCGGCGTCCCCCGGCTCTCCC
ATGTATGTGGACTGATGGAGAACGGCATTCTGGGTAACGG
AGTCCTGTGGCGTCCACGCATCACTGCCCGCTGACCTGAG
AGTGCGAAGATCCAGAGCAAACCAGGGCACAGGGTCTGAC
ACGGGAGCGCTGGTCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations