Transcript

mir7145-001

ID
ZDB-TSCRIPT-120906-1
Name
mir7145-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000005071 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000005071|ZDB-TSCRIPT-120906-1 CuratedMicroRNAMature mir7145-001 miRNA published 22 bp
ACAATGGAAGCCAATGGTTACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations