Transcript

macf1a-203

ID
ZDB-TSCRIPT-120702-344
Name
macf1a-203
Previous Names
  • macf1-002
  • macf1a-002
  • ottdart00000056175
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056175 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056175|OTTDARG00000015686|ZDB-GENE-030131-3606 macf1a|OTTDARP00000044050 macf1-002 LG_none BX511004.9,CR352282.5,BX004821.5,CR753876.17 Danio rerio protein_coding KNOWN, 684 bp
ATGAACTTCAACTTATGACGTTCAGAGCATTTGTTGAATC
AACCCAGAAGTCCCCTGTGAAAAGGAGGAGGATGCACTCT
TCCTCAGATGTCATCACACAGGAGTTCATGGATTTACGCA
CTCGCTACACAGCTCTGGTTACCCTGACAACGCAACATGT
CAAGTATATTAGTGATGCGCTACGAAGACTGGAGGAGGAG
GAGAAAGAAGTGGAAGAGGAGAGACAGGCCCGAGTGGGGC
AGGTCTCAGACCTGCTCGGGTGGGTCAAGGGCCTACAGGA
GCGCACAGGCAGATCTGCAGAGCCATCACTTGTCGCACAT
CAGGCTATTAGTGAGCAGCTAGCGGCTAAAAAAGAGGAAG
TTGCTGAAGCCATCAGGAGCACCCAAGTCTTCCTGATGTC
AAAACAGGCCAGCAAGCTGTCCCCTGAAGAGCGTGCCCAG
GTGGTCTCTCAGCTGGATGAGCTGACGGCAACATACACAC
AACTGTGTGATAGTTCTGCCGCACAAGTGCAACATCTAGA
AGAGCAACTGGCCAAAGAGGAAAAGCGCAAGGTTGTGCAG
CAGCAGAAGGCTGAATGTTCTCAAAAACTGGAGAGTCTCA
CAATGTGGATGGCTGGTGCTGCAAGTCTTTTGGCCAGTCA
GAGACCTGGAGTTGAGTCAGATGACGTGCACACATTACAG
GAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations