Transcript

crfb15-201

ID
ZDB-TSCRIPT-120702-319
Name
crfb15-201
Previous Names
  • ch73-222h13.4-001
  • ottdart00000055982
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055982 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055982|OTTDARG00000035153|ZDB-GENE-071120-6 crfb15|OTTDARP00000047672 CH73-222H13.4-001 LG_ BX323090.7 Danio rerio protein_coding NOVEL, 587 bp
TTTCCGGGATTCCACTCAGCTGTCAAGACGTTGTTATGTT
AGACTGATTTATGATGGTGATTGTGATGCTGTCAGTCATG
ATCGCGAAGCTCCTGATTCTCACACTCTTTGCGACAAAGG
ATGGACACCACATCTATGCTGAAACGAAGCTGGCTGCACC
TCAGAACGTGAAGGTGGTCTCCATCAACATGGGTGCAGTT
GTCGAGTGGACGTCTCCACACAATTCCATCAGGAACATGA
CGTACACTGTAAGATATGTTCCTTGCGATTGGGGAAATGT
CTCTTCCATCTGTGTGAAAACCACAGAGCTGAAATGTGAT
GCGGGAGTTTTGCCGTATGCATTTGGGTGCTACATTTTTC
AAGTGCGGGCAGAGAAAAATGGGATGTTCTCTGAATGGGC
TAAAGCACCCAAATTTATACCTCATCAGCACACTATCATA
GGACCTCCTGCTGTGCATCTCGTCATCCAGAATAACAGTC
TGGAAGTGACTGTTCGAGCACCCATTCTGAAAATCGGCAA
ACTTTCCACATTTTTTTCACAAGTGACCTACACCATCAAA
CACCGGATCGAAGGCATTGAAGATGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations