Transcript

znf1042-202

ID
ZDB-TSCRIPT-120702-264
Name
znf1042-202
Previous Names
  • dkey-81i14.3-001
  • znf1042-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052267 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052267|OTTDARG00000036678|ZDB-GENE-120703-14 znf1042|OTTDARP00000041082 DKEY-81I14.3-001 LG_ BX324003.7 Danio rerio protein_coding NOVEL, 2741 bp
ATTGGCTTATTTCGCCAAGTAAAGAGAACAACTTTGGAGG
ACAAACTACTATTGTAGATTCCTACATTGGGATTATTACC
AACAACAACCATTTTTTCATCCCACTTCTTCATTGAAGAC
TGAAAAGGATAAAGTGTCCAAACACAGAGAAAAACTCCTG
CTGAAGCGACTGATCTCCACACTGTTATAAAGATGGTGTT
TATTAAAGAGGAGAGTGAAGATGTGAAGATTGAAGAAACA
TTCACAGTCAAACAGGAAGATCTGCAGGAACAAACAGATC
TGATGGTGCTGAAAGAAGAGACTCATGGACAAAATGAAAT
AGATGAGAAACAGCAGTTTCAGAAACCCCAAGAAATAATG
ACTGATGAAAAACCCACACTGACTAAAAAGACTTCATCAC
ACGGAAGACTTCGGAAATCCAAATCTGGGTGTAATTTCAG
CTGTAAACAGTGTAGAAAGAGTTTCAGTCAGAAGTCAAAG
CTTGATGTTCACATGAGAGTTCACACTAGGGAGCAACCTT
ACACCTGCGAACAGTGTGGAAAGAGTTTTGGTCAAATACA
AGGCTTTAAAGCCCACATGAGAATTCATACTGGAGAGGGG
AAGTTCACATGCCAAGAGTGTGGAAAAAGCTTTTATCAAG
CTGGAAACTTTGCAGCACACATGAGAATTCACACTGGGGA
GAAGCCTTTCAGCTGTAAGCAGTGTGGAAAAAGTTTCAGT
CAAAAGTCAAACCTTGATGTTCACATGAGAGTTCACACAA
GGGAGCAACCTTACACCTGCGAACAGTGTGGAAAGAGTTT
TGGTCAAATACAAAGCTTTAAAGCTCACATGAGAATTCAC
ACTGGAGAGGGGAAGTTCACATGCCAAGAGTGTGGAAAAA
GCTTTTATCAAGCTGGAAACTTTGCAGCACACATGAGAAT
TCACACTGGGGAGAAGCCTTTCAGCTGTAAACAGTGTGGA
AAGAGTTTCAGTCAAAAGTCAAACCTTGATGTTCACATGA
GAGTTCACACTAGGGAGCAACCTTACACCTGCGAACAGTG
TGGAAAGAGTTTTAGTCAAAAACAAAGCTTTAATACTCAC
ATGAGAATTCACACTGGAGAGAAACCTTTCAGCTGTAAGC
AGTGTGGAAAGAGTTTCTTTCAAAAGCCAAACCTTGATGT
TCACATGAGGGTTCACACAGGGGAGAAACCTCACACCTGC
GAACAGTGTGGAAAGAGTTTTGGTCAAAAACAAGACCTTT
ACATCCACATGAGGATTCACACTGGAGAGAAACCTTACAC
ATGCACAGAGTGTGGTAAAAGTTTCCCACATATAAGCACA
CTCAAACACCACATGAGGATTCACACTGGAGAGAAGCCGT
TTGCATGTGCTCAGTGTGGAAAGAGCTTCACAACCAAAAC
TAGCCTCAAGAACCACATGAATGGTCACACTGGAACCATA
GTGTTCACATGTGATCAGTGTGGAAAGAGTCTCACACGCA
AAGACACCAAGAAAACATGAAGAAACACATGAAGACTCAC
TCAAGAGAGGATCGTTTTAGATGCAGTGAATGTGGAAAGG
GCTTTAAAAGTAAAAGAAGCCTCAACACTCACATGAAGCT
TCACAATGGAGAGGAGAGTCCTCAACATTGAGGCCTTGTC
CACACAAACACGAGTATATTCAAAACGGCAGCTTTTTCAC
GTAGTTTGGCTGTTCATTCAAGTGAAGTTTATTTATAAAC
TACTTTCAAGAGGATCACATGCTTATGATTGTCCACGGCC
GGTCCTGCATTAGCTAAAACATGATTCACCATTCAGATGA
TTCCTAACTCACTATAAATAACCTCTTAACTCAGTTATCT
TTGTCTTGAAGAATCCCTCTCCCACCCTTACTCCCCCTCC
TTTCTAGATTGGGCAACACGGCAGCCAATGAATAGCCAGT
GGTTAGCACTGTTACCTCACAGTAAGAATGTCGCAGGTTA
AAGTCCCTGCTAACCAGTTGACATTTTTGTGCAGAGTTTG
CTCACTCTCCTTGTGCTAACGTGGGTTTCCCCTGGGTCCC
CTGGTGTTCTCCCACAGTCCAAAAACACACAACCTAAGTA
AACTGAACATTAAATTGGCACCATAGTCGAGCTCTTAGTA
AGCCTTATATCTCCCTTTAGCCGACCCTATATCTGTCATT
AGAATAGAAAGAAGTCTGGGGAGTTCATCGAGATCTACCT
GAGCTCACACTCCCCTCTCGTCCTGCTTACGGGATGGAGC
CCAGGGCTCGAGGATCTTATGAGCTTAGGTCTCTCCCGGG
ATAGCATGCCAAACAAGTGTGAACTCTTGAATGCATATCA
AGTTACTGATAATGAAACCCTTTGAACACCTGAAAATTTA
AACTCAACTGAAGAGGGGTGAAGATCTTGCCAGCTGTTTT
GTAGTGTAGATCAGGGGTCACAGCCCAGTACCAGGTTGTG
AGAGTTGCTATCGGGCTGCAAGAAGGCAAAATAACTCTAT
ATGTTAATAGATTGTATTGGCTTGTTTCATATGCAACAAG
TATCTACTTCTGATAAGATGTGAACCAAATGACCTAGAGG
AACTCAGGAGATGTGACCCAACCAAAGCAGTTGGGTAATC
TCCAGGGGGGTTTCATCCTTTGTTATAAATTAGTGTCTCA
CAGACTGTATTTTGGTTTAAGTTACTTAAAGACAGACAAG
TTAACATCACTGCTGATGAACTGCACAATTAATTCTCTTC
AATAAAGTCTTCTGCCCGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations