Transcript

kidins220a-203

ID
ZDB-TSCRIPT-120702-180
Name
kidins220a-203
Previous Names
  • kidins220a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055666 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055666|OTTDARG00000006991|ZDB-GENE-041014-170 kidins220a|OTTDARP00000043653 kidins220a-002 LG_none CT737254.12,BX942833.8,CR383661.10 Danio rerio protein_coding KNOWN, 486 bp
CCATCACGCCCCCACCCGCCCTGCTTCTAAACTCCACAAG
GACCCCGGTCTGGGACTAGGCTCTGTGGTCTCTAGTGGAT
CTCAGGTCCTGCTCAGTTCTCTGACCATCGATGGAGTATG
TGAGAAGCTCAGACAGATCCAAGGCCTGGACTCCAGCATG
CTGGAGCAGTACATCGGCACAATCAAAAAGACGTGCACCA
GTGTTTGGAAGAAAAGTGGAAAAACAAGACTAAGACACAT
GGGGTGTGGTAAATTAGCCCATGATCGTCTATTGGAAAAG
AGTAGTTTTATCAGCTCCATGTGGTTTCACAATGAGGCCT
TTCTTTCCATTGGACAACATCTGAAGGAAAAGCAATGACA
TTTCTGATGCCTCCATTAGTCAACCTGCCAGCTGTGCCTC
TTCAGCCTGCATACATAAACATCTTTATTGTGAACTGAGA
ATTAACCCTTGACACAAAAAAGTTTGTCAGCCATTAAAAA
AAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations