Transcript

krt91-003

ID
ZDB-TSCRIPT-120213-90
Name
krt91-003
Previous Names
  • dkeyp-113d7.8-003
  • zgc:92533-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053199 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053199|OTTDARG00000014148|ZDB-GENE-040801-181 krt91|no_translation DKEYP-113D7.8-003 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 630 bp
TGAGCTGAAGATCCGCCAGTTCCTGGACAGCAAGACATCT
CCCTCTGCTCGGGACTACAGTGCCTACTATGCAACAATCA
GTGACCTCCAGAACAAAATCCAGGATGCCACTCGTATCAA
TGGAGGCATCTACCTCAGCATTGACAATGCCAAGCTGGCC
GCAGATGACTTCAGGGTCAAGTAAGTCCATATACAGTACA
CTAAAAGAAAAGCTATCACCACGTCAAATGGGCCTGAGTA
ACAATGGTTTGATTTCTGCGCAGGTATGAGAATGAGCTGA
GCATGAGGCAGTCTGTGGAAGCAGACATCGCTGGCTTGAG
GAAGGTACTGGATGAGCTCACAATGACCAGATCTGACCTG
GAGATGCAGATCGAGGGTCTGAAGGAAGAACTGATCTTCC
TCAAGAAGAACCACGAGGAGGTAAATTAGTGATTGGATCA
CACTCTTTAATAACTATGATATTTCGCCCAATGAGGCAAC
TGCTCAGTGGTTTGCTATTGCACCTTTAGGAGCTCTTGGC
AGCACGTGGCCAGATGAGCGGACAAGTCCACGTAGAGGTC
GACGCAGCACCACAGGAAGACCTGACAAAGGTCATGGCTG
ATATCCGTGAGCACTACGAGCAAGTTGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations