Transcript

si:dkey-37m8.11-201

ID
ZDB-TSCRIPT-120213-790
Name
si:dkey-37m8.11-201
Previous Names
  • dkey-37m8.11-001
  • si:dkey-37m8.11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052756 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052756|OTTDARG00000037024|ZDB-GENE-120214-18 si:dkey-37m8.11|OTTDARP00000041467 DKEY-37M8.11-001 LG_ BX005105.6 Danio rerio protein_coding PUTATIVE, 1645 bp
AAAATCAAACAGGAATCAGTGAAGAACAAAGAGGAAAACG
GATTATTGAGGATTTATTTCTGTACAGATTTCTGCAGATC
TGTGATTCTTTTGGTTTTTCTCTCTTAGAAAACATTTGGA
AAGTGAAAGTAAACTTGCTGGAACAGTGAAAATGTCTTCT
TTAACTGAATATGATTTAACTTGTCCTGTGTGTCAGGATA
TCTTCAAGACTCCAGTTCTTTTGTCGTGTAGTCACAGTTT
CTGTAAAGAGTGTCTTCAACAGTTTTGGATCAGCAAGAAT
ACTCAGGAGTGTCCCGTCTGCAGGAGAAGATCCTCAAAAG
ACTATCCTCCAATTAATCTGGGATTAAAAAATGTCTGTGA
GTCGTTCCTGAAGGAAAGAAATGAGAGCCGTTCATCAGGA
TCTGAGGAGATCTGCAGTTTACACAGTGAGAAACTCAAAC
TCTTCTGTCTGGAGGACAAACAGCCTGTGTGTTTAGTGTG
CAGAGATTCAGAGAAACACCTCAAACACACATTCAGACCC
ATCAGTGAAGTGGCTCCAGCAAAGAAGGAGGAGCTCAATA
CAGCACTGAAGTCTTTACAGGAGAAATGTAAACTTAATGA
AGAGATGAAAAGAGAGTTTGAGAAAACGGCTCAACACATC
AAGGCTCAAGCTGAGCACACAGAGCGTCAGATTAAACAGC
AGTTTGAGAAGCTTCATCAGTTTCTCCGAGATGAAGAAGA
AGCTACAATCACTGCACTGAGGGAGGAAGAGGAGCAGAAG
AAGCAGATGATGAAGGAGAAGCTGGAGGAGATGAACACAC
ACATCTCAGCTCTTTCACACACGATCAAAGACATGGAGGA
GATGCTGAAAGCCAATGACGTCTGCTTTCTGAAGGAGTTT
CCAGTCTCAATGGAAAGAGTCCAGATCTCACAGCCGGATC
CACAGATGCCTTCTGGAGCTTTGATTCATGTGTCTCGCTA
CTTGGGCAACCTGCCGTTCAGAGTCTGGAAGAAGATGCAG
GACATTGTCCAGTACACTCCTGTCATCCTGGATCCAAACA
CTGCATATCCAGAACTCTACCTGTCTGATGATCTGACCAG
CGTGACAAGAAGAGGAAACAGACAACCAGTTCCTGATAAT
CCAGAGAGATTTGACTGTTGTTTCTGTGTTTTGGGTTCAG
AGGGTTTTAACTCAGGAAAACACTGCTGGATCGTGGAGGT
TAAAGAGAGTAAACGCTGGAGTCTTGGAGTAACAACAGCA
TCAAACCAGAGGAAGGGAGAGGTTTTCTTTAAGTCTGATG
TCTGGAGTGTGTGTGATGGATGGTCTAGAGGGTCTGGTTT
TTGTGTTCTTCAGGATCTTGATCGAGTGCGAGTTGATCTG
GATTATGACAGAGGAACAGTGTCTTTCTCTGATCCTGTAA
AGAACAAACATCTACACACTTACACAACCACCTTCACTCA
CACTCTCTACCCTTTCTTCAGGTGTTTTCCCTCTTTCAGG
ATTTTAGCGTCCAGTGTTCAGTGAGATTACAGCTGTAGTT
CTGGATCTTCCTGTTTTCATCATGTCTCTAATATTTAATC
AGGTCAATATGAGTGTGTTGATCTGAATATCAGAATATCA
ATGTTTCAGGAAATTTACAATAAATTAATCAAAAGTGACA
ATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations