header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-699
Transcript Name: ubn2a-202
Previous Names: ubn2-002, ubn2a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054407 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054407|OTTDARG00000037998|ZDB-GENE-070112-612 ubn2a|OTTDARP00000042736 ubn2-002 LG_ AL954384.11 Danio rerio protein_coding KNOWN, 3995 bp
TTCGGATCTCCTGAGTCCCCCGAGCGTAGCGACCGAGGAT
GCTTGCGCCTCCAGAATCAACTTTCACCCGGCCATCCCTT
CACATACGCACCCCGTAAGGTGCGGAGGGTACTCTAGCAT
CGGTACAGCCTCCGAAAGCCCCTCGAATCCGGCTTGAAGC
TCTTTAAATCAAGTTGTTTGGCGAAGTCAAGCCCCGCCAC
TGATAGTGAGTGAGTGAGTGTCCAGGAGCGCTGAACATCC
AAATGGCCGAACCGAGAAAAGTGCAGTTTGTCACCCTGTC
GGCCCTAGCCGGTGGTCCGGGCGCGGATAACAGGAGACGG
CGGCTGGAGGAGGACGGGGCCGCCGAGATGAGTTTTGACA
GAGAGGGCAGGATGAAGATGATGGGGACCGGGGTGACGAC
AGCGGGTGACCGCGGGGGCTTAATCGGGAAGAGAGACAGC
GAGGAGCCCAAAGGGAAGACCGTGCGCCTCAACCTGTGTC
TGTCCGAGCCCAGCGAGCAGTGCTCGGCCGAGTTCAACTA
CAGCGAGCTTATCCAGTCTCAACAGCCCAAGAAGAATCCA
CCATGTTCAAAGTCTTCCCTGGACCCCAATGATCCCTTTA
ACGATGATGAGAAGGAACGTCTGCAGGTCGAAGCCCTGGC
CAAAAAGTTCGAAAGCAAATACGGTAATGCAGGGAAAAAG
AGGCGGAAAGATCGGATGCAGGATTTGATTGACATTGGCT
TCGGCTATGATGAGAGTGACCCCTTCATAGACAACTCGGA
AGCATATGATGAGCTTGTACCAGCCTCCCTGACCACCAAG
CTTGGCGGATTCTACATTAATACGGGTACTTTGCAGTTTC
GAGCTGCCTCTGAATCGGAGGGAGAGGACAAAGTGAAAGA
TGAAAAACCCAGGATAAGAGATGGAGAAGAACCACTGATG
AAAAGAAGGAAGAAGAAAGATGTAATCGGTATAGAGGAGA
AAAAACCCAGGAAGAACAAAGTAGCAAAACAAGGAGTGGC
TGGTCTCAGCCTTCATCGTCCTGAGAAAAAGAAGAGAAAG
AAACTGATGAAGGATTCTCTCTGTCTGGCTGCAATGCTCC
GCCGCTTCACTCGAGAGAAAGAAGAGATTCGGAAACAGGA
CATCAGCAGTTCTCATTTGGGTCTCACCAGCGCTCCTAAC
TCCAACAACCTACTGCAGAACTCTCATTTGCACATTGGCC
ATGCCAACCACACTGACCTCTCTCTAGCTGACCTGACCGC
TGACCCTGCCATGATGTCATTGCTCAGTTCGGCCAATGAG
AGTGAACTCCAGGATATCATGCGCGACCTGGACTTCAGTT
CATTGGACGCAGCGCCCCAGACTCCCCCATCATGCAGGGA
GAATGGGCAGGTTGGGATGGGTTCGTCATTGGGGAACAAA
ATTGGAGTAGGGGGGCTGAATCGAGGGCAGGCCGGGGTTG
TGTCTTTTCCAACTCTTCCCAATGGACTTCCAGCACCTCT
GATCAAGCGCATAGAGGACCTACGAGCCGCATCGAGGCAA
TTTGATCAAGAGGGCAGAAAGAAATTCTTCACTCTGGATA
TGAATAATATCTTGCTGGATATTGAGCTGCAGGTTCAGGA
GCAGCCGGACCACGTGCGTTCAGAGGTTTACTCTCATCTA
GAGGCCTTTGTGCCCTGTAACAAGGAGGCGCTACTCAAAC
GACTGAAGAAGCTCAGCCTCAACATACAGGATGACAGTCT
CCGCACACCCTTGTTAAAGCTCAAACTGGCTGTGTGCAGC
GTGATGCCAGAGCAGATCGCCAGATATAACATGGACTGCA
TGGCAAAAGTTGCCGCCAAACAGCAGATAGAAGATGGAGA
GAAGAACGGATCAGAGGATGACGATGAGGAAAAACCAGGA
AAGAGGGTGATGGGACCAAGGAAGAAGTTCATATGGGATG
ACAAACTCAGGACTCTGTTGTGTAACCTGGTGCGTGTGAA
GCTGAGCTGTTACCAGTTGGAGCAGTGCTCTCTGTCTGTG
GAGGACTATCTCAAAGCCTTCATGGAGAATGAAGTGAAGC
CCCTGTGGCCCAAAGGCTGGATGCAGACCAGGATGCTTTT
TAAGGAGAGTCGTGCAGTACATGGACACCTCACTGGCCTA
GGCAAGAAAAGGATTGTTCCAACCCCAAAAGCTGCCAAAA
TGACGGATATGGTCTGGACACAAAGACCTGCTCCAGGTGT
TGGATCCACCTCAGCCTCACCAGCCTTACCTGCGTCTGCA
TGCAGACCTTCATCCCCGTCTGAGCCCATCTGCCTCTCAG
ATTCACTGGATGAGGATCTGGCAGCCAACTCTCTGGACTC
CATCTCCCAAGCTCTCGCTCTCCTCAGTAACGCTGCCAAG
GGCCTGACGCCCAACAACGGCATCGCCGCCTCCTCTGCTC
CCAGTGTCCCCGGATCCTCATCAGGAGTCACTCACTACTC
TTCTCCTCTCTCACATTCCACCCTTTCAGCAAAAATGGAG
CCTTCCGGTATCCCTCTGGGGAATATGAGCAGTATATCTA
CCTCTCCTTCCCTCTCCATCTCGTCTCCGTCATCTTCCAT
GCGAGGTGACAACTTCGGGATGCTAAAAGACGGCGGGGCC
TTGCAAAGACTCTCGGGGACGCCGACTCACAGAGCTGGCA
TTTCAGGAATGAGCACGGTGCAGTCCGCAAAACCCCGTCC
ACCCCCTACTGCCTCACCCCTCTTGCCTCCACAGCAGAGG
TCATATGGGACAATGGGAGTGAAGATGGTCCAGACTCCAC
CCCTAGTGAAAAACTGTGCTAATAAACCCACTACTGGTGG
CAATACTGTAGTTTCTCAGCCACGTGTGAACGCTAATCCC
TCACAGCAGTCTCCTCCTCCTCCGACCACGTCATCTCCTT
CTACCTTGCTGGCACAAGTTAAGACTATCCCACACAACCA
GTCGAACTTCATCACGCCAATGCAGGCCACTCTCACTAAG
TCCTCCCACAGTAGCAACTCTCCCATCATCAAACTCACGC
CACGACCCCCTGTTCCTACTCCTCCTCCATCATCTTCACC
CTCGCCTTCATCATCCCCTTCTCTTACTCATCCCAGACCC
CAATTGATCCCCACCTCACATCAGTTCACCCCTAAGAGCC
CTGCATTCAGGCCTCCCTTCACCACACAAGCTGCCGGAGT
CACATCTGCGGTCAAATCCATTTCAGGACAAGCTAGTTAC
AGTTTTGCAGGTGGACACAAATCCGCCAGTCCTCCTGTTG
GTGGAGCTAGCATCACCAACACCACCCCAATGACTGCACC
CCTGTCTGCTGCGTGCAAGGACGGCAGTCCCTCCCCTTCT
GCACCACTAGCCAATCACAACCAGCGGCAGAGGCAGGTGG
GAGGGGCTAGCCAGGTTGCCAAGTCTTCAACAAGTCGGGC
ATCAGCCATGACCCTGCCCTCTCCACCGGTCTCCTCTCAT
CTGTCACAGGGGTCTCCGTCTTCTGGAAGTAACCTGTTGG
GCTCTGTGCCCCCTTCACTCCCCTTGGGTTTTGGGATGCT
CGGGGGTCTAGTGCCTGTTTCTCTCCCCTTCCAGTTCCCG
TCGCTCCTCAACTTCAGCCCCACAGGTCCCGGAGTCCCCA
GCTGCAGTAACCTGGGCTCTTCACCCGCCCCCAACTCAGG
ATACACGCTGGCACAGAATCTGTTTAAAAGTCTTCAGCCA
GGGTCTCAGGTTGCTCTACCTCCTCACTTGCAGCTTGCTT
TCTCAGATGCAAACCAAAGTCAGGGGGGAGACACGAAGAG
GAAATCCCACTGACCTCCGCCGGCAGAATGTAGATGTGTT
CAGCTGCTCGGATCAGATGAGATGGTGGACGGACACTGTA
CTGCGCATTCATCAAGCCCCCTTCAGTTAACACCGTTCTG
CTTTGAATCCGTCAGGATGATTGGAGTGAGCTGCTGCATT
TTACTTAGATTTTGTTCGTCAACATGTTTACACGAGACCT
TAATCACTGTGGACTTTGAACTAGAGGAGGAAGAA

ubn2a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ubn2a-201 (1) 5016
ubn2a-202 3995
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubn2a-202 Contained in:

OTHER ubn2a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054407 (1)
  • Ensembl_Trans:ENSDART00000151697 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT729877 (1) 890 bp
    GenBank:EG585215 (1) 825 bp
    GenBank:CT654284 (1) 806 bp
    GenBank:DY544304 (1) 750 bp
    CITATIONS (2)