Transcript

nip7-201

ID
ZDB-TSCRIPT-120213-50
Name
nip7-201
Previous Names
  • nip7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053017 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053017|OTTDARG00000037211|ZDB-GENE-050522-256 nip7|OTTDARP00000041692 nip7-001 LG_ CU927919.13 Danio rerio protein_coding NOVEL, 849 bp
GACAGATCCAACCCACGTGGCGTACACACTGCGAGAGCGG
TTGTGTTTTTTCAGATCTACGGTCATCTGGAAATAAAATA
GTTATTAATTTTCATAATGCGTCCGTTAACAGACGAAGAG
ACGAAAACGATGTTCGAGAAACTCTCTAAATACATTGGGG
AGAACATCAAGCTTCTTATCGATCGGCCGGATGGGACTTA
CTGTTTCAGACTTCATAATGATCGAGTATATTATATGAGT
GAAAAAATCCTGAAGTTGGCAACAAATGTCTCCAGAGATA
AACTGGTATCAGTTGGCACGTGTTTCGGAAAGTTCACGAA
GACACAAAAGTTCCGCCTGCACATCACAGCTCTCGATTTC
CTCGCACCGTATGCTAAGTTTAAGGTGTGGGTGAAGCCGG
GATCGGAGCAATCATTCCTGTACGGAAACCACATCATGAA
GTCCGGCCTGGGCAGAATCACAGAAAACACAGACAAGTAC
CAGGGAGTGCTGGTGTATTCAATGGCTGACGTACCACTCG
GTTTTGGAGTTGCAGCGAGAACAACACAGGAGTGCAGGAA
AGTCGACCCCATGGCTATTGTGGTTTTCCATCAGGCTGAT
ATTGGAGAATATATCAGAAGTGAAGATACTCTGACATAAG
ACGATATCATTGCTCAGTTTGGCATGGACGGTTCATTACA
TTCTGGCGATTGGATACCTTTATTTTTTTCTTCCATCTTA
TAGGCGTGACATGCTTTGAATTCAAAGCATTATTGTCATC
ATTTTTCACCCTGTTGCCTTCTTTTCAATGTCTAAATACA
TATGTGAGTTTCTGTTAACCATTTCTGTATTAAAGAAATA
CTAAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations