Transcript

urgcp-201

ID
ZDB-TSCRIPT-120213-493
Name
urgcp-201
Previous Names
  • dkey-204a24.10-001
  • si:dkey-204a24.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053261 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053261|OTTDARG00000037342|ZDB-GENE-120215-160 si:dkey-204a24.10|OTTDARP00000041902 DKEY-204A24.10-001 LG_ CR628394.17 Danio rerio protein_coding NOVEL, 5839 bp
CAGTAACGCTAAAAAAAAAAAACCTGTTTTACATCAAATC
AAAACTGAAACCCTCATGCCTTGACCGAGTATTTAAATCT
CCAAGTATGACAGAGACACAGAGACCATTATTTGGCTCTT
GAGGAGGAAGCGTCTCTCAAAATAAGGTGAATCAGCCTGC
TTTGAAGCAAAAGATGGAGGATCCTGGTGAAAGCACTGCT
ATTGAAGATCAAATTAGGATCACAGATGTCGGCCCTCATT
CTGTGCGATTAGCATGGGGAGCTGCAGGTGTGACTGCAAA
TAAACAACAAAAATTCCAAGTCGAATGGAAGAATGAAGGA
ATACACTTTACAAAAACAACAGATGCAAATCATTTTGAGA
TAAAACAACTCACGCCTGGCACTCGGTATAACATCACGGT
ACTGGAAACTGAGGAATCCTGCCAGAGCTTCTCTGCATCC
GTGTGTACAGCAATCCCAGCACCTGAGAACTTTGAATATG
TTGCAATGGACGCAACAACTGTAAGACTAAATTGGACATC
ACCTCCAGAAATGGATCCCAGTTTCTACAAATTCCAAGTG
ATCATGTATAAAAATAAAGAGAAAACCGAATCAGTGACTA
TGAAATCAGACTTAAATACCATTGTAATGATAGACCTTCT
TCCTGCCACTGAGTACAAAGCTACAATAAACACAATTCTG
GAGGATGATAAGCAAAGCAAACCAGTTGCTTTAATCGTCC
ACACACAGCCACTTCCACCCACAAACCTACAAATCAAAAA
TGAGGCAACTTCTGTTACTCTGAAATGGACCGATCCCATC
ACTGATGACAAGATTCCACACAGATTCAGAGTGATATGTA
GCGGTGAAGCCAATCGAATGGAAATGTTTACCGATGAAGA
AGAGATTAATGTATCAGGTCTAAGCCCTGGCATGGAATAT
TCCTTCTCTGTCTACACATTAGTTAAACTTAATGACACAG
AACTTGAGAGCACTTCTGTAAAAGTCACACAGCGCACAAA
CATAAATATGGAATATATGTTAATGGAACTGGGTCTACAA
AGCCACTTGAAGAATAAGCTCACTTTGAAGTCTGTGTTGG
AATTAAGGAGAATGTCAGATGAGAACCAAGCGCAAAGTTT
TAAGGATTTGTCCTGGCTTTTTCTCAGAAAGCTCATGATG
GTCAATTCATCAGCTAGAAGTATCAAATGTGCCAATACCT
CTACTGAAGATCAGAAAGGTGTAAATCCACTAGATTTGAT
CACAGCTCTTTTCCACTGTGCTGACCCTTTCCTCCAGCAA
GAAATGGCTCTAAAAATGTCACTGTGTCAGTTTTCTGTGC
CTTTACTGCTGCCAAACTGTGACACAAAAGAGTGCACGCT
GATGCTTTGGGCCTTGAGGGACATAACAAAACAGTTCAGA
TCCCACTCATTGAGAAAGGACTGTTCAGGGGAAAACAGTA
TTGTGCAAACCGATTTCCCCCTGATCTCTTTTGTTAGACT
GGGAAAAGGTAAGTTGTCCAAATCTGAGTTTCTGAATAAA
CTCATCAGCAACAATCAGCAAAATCATGACACTTTTGTTC
ACTGGAAAATTGCAAATGGAAACTTTCCAAGAAAGATCTG
TAATGGTCTTGTTGAAATGACCTGGTATCTTCCTTGCGGA
AAGGAAACTGACAAATTCAAAGAGCCAATCGCTGTGGCTA
ACCTACGAGGGGATATTTCTGAATTTGAGGTCCAATTGGC
CTTCTTGAGCCAAGTATCCTCTGCAGTTTTTCTGTTTTGT
GATGATCTGGATTCAAACCAGACACTTCTGAATTCCCTGC
AGCTCTCAAAACTGGTACTGGTTTGCAACACAAATGATCT
AGAATCAAGAAACGATTTGGAAAAAAGTTTGGCAGAGCTA
ACGCTCAATACGCACTCAGTTATCTTCAAGGACGTGAAGA
TGAATGATGATGACTTTGTTGCTAAACTACAGATGACTGT
CGATGAAATACTTAAACATTCTACAAGCGTTAGCATCAAA
AAAATGTCTGAAATTGCCCCAGATCTGGGGATCCTTGTAG
ATGAAAATGATGACATTTGTCAAAATGCAAAGAAAATGGC
GGAAACAATGACGAAAGACATTGACGATATATCTCAGTTT
AAAATAAGACAATTACCTTTGCAAGGGGAAAAGTTGAAAG
AGGTTTCCGAACTGGAGAAAGAAATGTGTCGCCTCAGAAA
GGCAAAGAAACAAAACATTGAGCACTACAAGGATGAACTT
AGAAGTCGAATACACAAACTGAAAATGGAACAAGAAAACA
GCAACATGAAACAAGTGATATCTCTGTTCATCTCTGGCTT
GTGCTGCTCATCAAAATTCCAGATGTATTTTCTTAAATGG
ATGAAAATAATGTTGGACAGTCTAACAAGACAGCACCTGT
CCAGTCTTGATGAGCAGTATAAGGAAGCATGTAAGAAAGC
CAGAAAAGAAAAAGAACACCTTAGAAAACTGGAAAATCAT
ATTGCCAACAGCTCTTTAGGGGTTCAACACTTCATGAGAG
AATTAAGTCAGCTTTATGAGTCTGCACACTCACATGAAAC
CTGGAAAAACCCTGCCCTAAAGAACTTACCAAAAGTATGT
GCTCAGTTGATGCTGAATGGGTTTCCTCTGGAGCTTGTTG
ATGGAGAAGCATCGAACATTCCACTGACGTGGATTGGAGA
TGTGCTTACAGCACTCAACAAACTGACAGCACCTCACAAT
AAGATCAGAGTCATAACAGTTTTAGGGGTCCAAAGCACTG
GGAAGTCTACCCTCCTCAACACAATGTTTGGAGTTCAGTT
TGCTGTTAGCAGTGGCAGATGCACAAGAGGAGCGTTCATG
CTTCTGTTAGGAGTGTCTGAGGAATTCAGAGCAGAGCTTC
AGTGTGACTATCTCCTAGTGATCGACACAGAAGGATTAAA
ATCTCTGGAGTTAGCAAAACTAGCTGATAGCTACGAGCAT
GATAATGAACTTGCAACCTTGGTTGTTGGATTGAGCGACA
TCACTATTGTCAACCTCGCGATGGAAAATGCTGCAGAGAT
GAAAGACACTTTGCAAATCGTTGTCCATGCCTTTCTCCGC
ATGAAAGAGGTGGGGAAAAAGCCTTGTTGTCATTTTGCAC
ATCAGAACGCAGCAGATGTCGCAGTGCATGATAAAACCTT
GAGAGAGAGAATGAGTTTCTTTCAACAGCTAGACGTTATG
ACTCAAGCTGCTGCCAAAATGGAAAAAAAGAGCAGCAACT
ACACTTTCACAGACATCCTAGAGTATAACATTGATGGAAA
CAACTGGTACATACCTGGACTGTGGCTTGGGACTCCTCCA
ATGGCACCTGTTAATACTGGCTACAGTGAAGGGGTTAACA
AGTTCAAGCATGGTATACTTGACATTTTAAAGAAAACAAA
AGTCCCAGCACAGGATTTTGTGGCATTTGCCGAATGGATC
CGAAGCCTCTGGAAGGCTGTACAATTTGAAAGCTTTATTT
TCAGTTTTCGCAACAGCCTCATTGCCGAGGCGTACTCCAA
ACTTTGTGCTGAGTTTAACACTTGGGAATGGGTGTTCAGG
AAGCACATGATTGATTGGTGCACAAAATCTGAGACCAAAA
TCACTAACATGGGTGCAGTGTCAGCGCAGTCAGGGGACGC
AGTTAACCTTGATAGAGTATTAGCTGCCTTAAAATGTGAA
GCAGATAATGAGTTGGGGAAAAAGGAGAAAAGCCTTCTAG
ATTCAATTCAGCAGTACTTTGAAAGTGAGTTGGAACATGC
ACACCTTGTGGAAGATCACAAGGAGGACTTTTTAAATAGT
GCACGGGGCATTCGAAAAGAGGTTCAGACAGATATACACA
TCAAACTGGAGAACGCTATTTTGATACAGAAGGGAATTGA
GAAGGTGGAACTTATAAAACAGAAGCAGAGGGACACCATG
AAAGAAAAAGTCCTTAATTTAATTCAAGTCTGCAGGAGCA
GAACAAATAAACTCTGCGATAGTGAACTGAATGGGGAATT
CGAAAAAATATGGAACGACATCGTGAAGCAGAACTCCTTC
TCAGCTCTGCCTAGACAAGATGTGGTGAAGGAAACCTACA
GACTTTTACACAGCAACTTGGAAATGAAAAGTGGGGCGGT
ACGTGAGATGCTATCAACTGTCACCAGTCTCGATCAGTGT
GGAATTGGACCATTCTTTGCAGTTGCAAAAGCACATTTTT
TCACAAGATTCAGAAATTCCCTGCGGCCCGCAGAGCGGAA
TAAAAAGCACAGGTTAATACAACTTGCATGTGACAAAATA
ATAAATGAGAGCGAAATATTTATTAAAAATAAGACGGAGC
CAAAATCAGATTACAACAGCGCTGACATACAAGAGCTATT
GTGCTTCATTGACAAGAATTTGGAAAGCTGTAAGGATCCA
CAGATAAGTCCTGAAGTTGAAGCCGCTCTCAAGATCCACA
TATGCGGAAATGCAGCAAGAGCTTTCCAGAAAATGCATGA
TGACTACTTACAGAAGAACGACCCATTGAAATCCCTTCAA
CTGTTCAAGAAGGAATGGTTGGCTGACTTTAAAGACCTTT
ACTATGAACGCGACCAGTGTCAGAACAAGGCAGAGATGTG
TGCCATGCAGTGCTTCGCCCCTGCTGTGATGGAGTACATC
CAGAAACGTCTTGGGCCTGACATTGTGGATGAAATGCTGA
GCGGTGAAAGAGGTCTTGAATTTTGCACAAGATCATTTTT
CCAGTGCTCACTTTTAAAACAGCTGCTTTGGGATGATAAC
TTTGACAATATTCTAGAGTATGTACGCAACTATGAAAGCT
TTGTAACTAAGTGGATTTCAGAAAGGATTACTGAACATTT
TTCGAAGAAAGGGGCTCTTTCGAAGTTGGAAGTAAAGCAC
TTGAATGATATCATCAACAAAATCAAGGAAGCTGTTGAAA
GTGTGCAGAAGGTGGCAGGCGTCCCTACGAATATTTGCAG
GTTTGTGACTAATGTCTGCAAAAATCTAAATAAAGAGTTG
GTCATACAAACAGACACCCTCAATGCAACTCTAACTTTAA
ACAACTCTAACCCTGCCGAATTCATAGATTGCTTTAAATC
TTCAATAGACAAAATGCATAAGCGATTAGTAGATCAGCTG
CACGCTGAAACGAACGCAAGAGATAAACTTACCAGACTCT
CTGTGAACAAACCTCAAGAGGTGCTCTTCAACAGAGTGTT
TGGCTGTGGAAAAAAGTGTCCGTTCTGCATGGCACCTTGT
GAAGCTGGTGGAAAAAGGCATACAAATCACTTTGTGTCCA
TTCATCGGCCACAAGGCATTGGCTACTATTCCTGGGTCAC
TAACAATAAACTAATTGCTGACATATGCTCATCTCTAGTC
GCAAGTGAAATGACGTTCCGCCATGAAGACACAGGATTTC
AGTGGTATCCCTACAAGGAATACAGACAATTCTATCCAAA
CTGGAGGATACAGCCTGACTCTAGTATCGAGGCCACTGAC
TACTGGAAGTACATCTTTGCCAAGTACAACTCTAAATTTG
CTGCACAATACAACGTAAAACCAGCAGACATTCCTGATAG
TTGGTACAGAATCTCTGTACAACAGGCTAACAAATGCTTG
GAAGATACATTCAAAATGAAACAATAGAAAGCTACCGATG
GACAACATCAATAAATTGTGGAAATGAAACAATGGACAGG
TGAACTGGAAAAGTCCACAGAATTCTAAAACTTTTAACAT
TTTTTTCTTTAGATAACTAGTATTTGCTGAATGGTAGTTC
ATGAAGAAACAAGCCTTGATGCAACAAATACAGATTTATT
AATGTTGTCTATTAAAATATTTTTATAACGAAACAATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations