Transcript

atp11b-201

ID
ZDB-TSCRIPT-120213-405
Name
atp11b-201
Previous Names
  • ch73-163i13.1-001
  • si:dkey-211e20.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052758 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052758|OTTDARG00000037026|ZDB-GENE-081031-13 si:dkey-211e20.10|OTTDARP00000041469 CH73-163I13.1-001 LG_none BX005105.6,FQ790212.2 Danio rerio protein_coding PUTATIVE, 3141 bp
CGCAAACCGCAGAAGAATGAGTGTGATCCTGCAGACACCT
TCAGGCAAAAGGTGCTGTTCACTAAAGGAGCCGAATCCGC
CATCCTGCCCTACACCAAGAGCGGTGAGATCGACAAAACC
AGAGTCCACGTGGACGAGTTCGCTCTGAAGGGTTTGAGGA
CACTGGTGGTGGCCTGCAGGCACTTCAGTGCGGACGAGTA
CAGAGATGTGGACCGGCGGCTCCATGAGGCCCGGACGGCT
CTTCAGCAGCGAGAGGAGAGACTGGTGGAGGTCTTCAACT
TCATCGAAAGAGACCTGGAGCTGCTGGGGGCCACTGGGGT
GGAGGACAAGCTTCAGGATAAGGTCCAGGAGACAATTGAA
GCTCTGCGATTGGCTGGAATCAAAGTGTGGGTGTTGACAG
GAGACAAGCACGAGACGGCGGTCAGCGTGAGCCTCTCCTG
TGGTCATTTCCATCGCACCATGAACATCCTGGAGCTCGTG
CAGCAGAAATCAGACAACGAGTGCGCAGAGCAGCTCCGCA
GGCTGGCCCGGAGGATTAAAGAGGATCATGTGATCCAGCA
TGGGCTGGTGGTGGACGGGGCCAGTCTGTCTCTGGCTCTG
CGGGAGCATGAGAAACTCTTCATGGAGGTGTGTAAGAACT
GCTCGGCGGTGCTCTGCTGCAGGATGGCACCTCTCCAGAA
AGCCAAGGTGGTGCGACTGTTGAAAACATCCCCAGAGAAG
CCCATCACATTAGCCATTGGTGACGGAGCCAATGACGTCA
GCATGATCCAAGAGGCTCACGTTGGTATTGGAATCATGGG
AAAAGAAGGAAGGCAAGCCGTGCGAAACAGCGACTATGCA
ATCGCGAGGTTTAAATTCCTCGCCAAATTGCTGCTTGTGC
ACGGCCATTTCTACTACATTAGAATAGCAACCCTCGTGCA
ATACTTTTTCTACAAGAATGTGTGCTTTATCACTCCCCAG
TTTTTATACCAGTTCTTCTGTCTGTTCTCTCAGCAAACTC
TCTATGACAGCGTGTATCTGACGCTGTATAATATCTGCTT
CACCTCTCTGCCCATACTGGTGTACAGTCTGTTTGAGCAG
CTGGTGCATCCTCACGTTCTGCAGAGCAAACCAGCACTTT
ACAGAGACATCAGTAAAAATTCCCTGCTCTCCTTCAAAAC
CTTTTTGTATTGGACCGTCCTGGGCTTCTGCCATGCCTTC
GTCTTCTTCTTCGGGTCCTACATCCTGATGGGAGAAGACA
CCACGCTGATGGGAAACGGACAGATGTTTGGAAACTGGAC
GTTTGGCACTTTAGTATTCACTGTGATGGTTATTACGGTA
ACACTGAAGCTGGCCTTAGAGACACACTTCTGGACGTGGA
TGAATCACTTCGTCACGTGGGGCTCCATCGCCTTCTACTT
CATCTTCTCCCTGTTTTACGGCGGCATCATCTGGCCGTTC
CTTCACACGCAGGACATGTACTTCGTCTTCGTCCAGCTTC
TGTCCAGCGGCTCGGCCTGGTTCGCCATCATCATCATCAT
CATCACCTGTCTGTTTCCTGACGTCATCAAGAAGGTGTTT
TACCGGCACCTGCACCCCACCAGCACGCAGAAATCTCAGT
TTATTGAGGCCTACCAGGGCATCGGATGCGTGGACTCCAT
GTGCTGTTTCTCAGAGGGGCAAAACGCCTGCTCACGGCTG
GGCCGGCTGGTGGAGCGACTGATGGGCCGCTGCGACCCAG
CCCGGACCCCCAGATCTTGGCACGACTCCGACACCTTCTT
CTCCAACGACCGGAGCATCCTGACGCTCTCGCCCATGGAG
GTCTCTCATTGTTAAAGCACCAGCCCAAAAAAACAAAAAA
AGGGACCGAGTTTGAAGACGCCTGCCCCTTTACCTCCCTC
CCCCCACTTGTCCAATCACCAGCCAGACTTTCTCTGATGT
CACACTTATCAAGCTCTGTTAATCAGAGCATATAATCAGC
AACGAGGAATACGCAGTGGTCCCCCCCAACAAATAACCAA
AGGATTGGACTCTTGAACGCTTCTGTGTTTTCGGCTGCTC
ATAAAAACCTTGAAACTGTACACAAATGGCCGCCGTCTTT
CCTGAGGAAAAATGAAGGAGGTCTGTTTTTGAAGCCATAT
AATTCCCTCCTTTAATTGCCTGATTTTCAAGGTGTATTAA
ACATGTGTAGCGCCAGCTCACCAAACCTGTAGCCTCCTAC
CCTAAGATGCCTACCTGTACACCCGGGTTGTACAGACTTT
ACCACGATGCAAGAATGTCGAGGAGGGAAACTCAAGCATA
TCATCCTTTAAGCCTCCATCAGTCATGTGCCTGCATATTA
TGTCTCGTTTTCCACTGTTGCATGTTTTATTTTCGGCATT
TCTGTCCACAAAACATTGCTGTGTTTATTTTTTTTTCTGC
TTGTGTTGCTAACCACTTGTCAAGCGCTGTTTGTTTGTCT
GTGTGTGTGTGTGTTATTTAATCTCGTGAGAGGGCATAGT
CTTGAACTGAATAATACTCGTCCTAAAATAAGGCCCGGAG
CATTGAGACAACCGTTTTAAACTTGCTTAGATCAACTATA
TTGAAGTTTATGATATCAAGACTGCATGCTACACATGTCT
CAATAATCCTATAAACAGAGGCCTGAGGAAACTGGACCTA
AATGCTCCCATTTTGAGGAGTCTCATCTTTTTTGGGGGCG
GATTTCTCTTTATTTTTGTGCTGCAAGACTGAGGATTTCG
GGTGAAATCTGGTGCCGTGACCCGGATGGGAGTTGGGAAT
CTGCATTTATGTTGGAGTATGGTTACATTTAGATTATTTT
CTATCTTCTTCTCTTCAGTTTTATTCGTATATCACTTTTC
ATGTCAATGTTCAAACCCCAAACGACTCCCGACCGCTGAT
CATAACTCTGTTTGGCTATATAATGTGTTGAATTATATAG
CGACGCCACTTATTACTCAGAGACATTAGCAATAAGACTC
AATCTAGACTGGAAATACCTGATCTAGCCGTGATGTCAGT
CATCCATAATGCGGTTGCATCTTTATTTTCGTGTGTGTAC
GTATTCATGCGTTCTTCTTCTTGTACTCTCCTTAATGGTG
AACATGTTTAATTGCTGATGTTTATGAAAGTTCTATTTAC
AGAATAAATACATTTATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations