ZFIN ID: ZDB-TSCRIPT-120213-265
Transcript Name: clasp2-008
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054173 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054173|OTTDARG00000015732|ZDB-GENE-040426-2343 clasp2|no_translation clasp2-008 LG_ BX324146.10 Danio rerio protein_coding KNOWN, 236 bp
GTGTGTGTGTGAACGGTGGTGCTGATCCGTTCGGGTGTAT
TTCGTCGCCGTGAGAACCGCTGTCATGTGAGCGGCAGCTT
GGGCGTTGCCTCGGATACTAGAAAGAGAGCCACGCCCGCC
GTCAGGCATGAGGCGCCTCATCTGCAAACGCATCTGTGAC
TACCGTAGTTTCGACGATGACGACTCTGTGGATGGAAGCA
GGCCGTCATCGGCTCAGGCGGCTTTTAAAGTGCCCA

clasp2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA clasp2-201 (1)    Ensembl 832
clasp2-202 (1)    Ensembl 5536
clasp2-204 (1)    Ensembl 4501
clasp2-205 (1)    Ensembl 4788
clasp2-206 (1)    Ensembl 708
ncRNA clasp2-006 (1)    Ensembl 829
clasp2-007 (1)    Ensembl 489
clasp2-008 236
clasp2-009 (1)    Ensembl 625
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clasp2-008 Contained in:
[BAC] CH211-207C15 (1)

Genome Resources: Vega_Trans:OTTDART00000054173 (1),  Ensembl_Trans:ENSDART00000151086 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB777320 (1) 236 bp
CITATIONS (2)