Transcript

buc-201

ID
ZDB-TSCRIPT-110912-892
Name
buc-201
Previous Names
  • buc-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052656 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052656|OTTDARG00000036959|ZDB-GENE-070117-694 buc|OTTDARP00000041393 buc-001 LG_ CU693487.5 Danio rerio protein_coding KNOWN, 2640 bp
TGCATTAATGTGGATCTCTGGAAACAGACGAAACCTATAA
ATCTAAAGTGCAAAGCTGTAGCTAACAGAGTTAGTCGCTC
TCGCTCTATATTACACATTTAAGTCCACTTTGTCACTTTC
ACATCTAAGTATTGCGGTGTTTTGTATCCTGTGCTGATTT
TCTTCGTCTCCTCGTAGGAAATGGAAGGAATAAATAACAA
TTCACAACCAATGGGAGTTGGGCAACCTCACCACCCAGTA
AACCACACAAGACCATTTTTCTATGTTCAGCCACCATCTC
AGCCTTATTTCATGTATCAGTGGCCCATGAATCCATATGG
CCATTACGGTTTTCCCGGGCCGGCTTTGCACTTTGGCCGT
CCCTATATGGCCCCTTATCAGTTTATGCAGTATCCTGGCT
ATGTGATTCCACATGCACCCATGCAGCCAATTGATTACAG
AAGAATTAACCCCCACTACCCCTCAGTTGCATCCTATGAT
CTGCGTGTTCGTCACCACTTTCAAAATGCTGGGATGCATC
GGGAAACTGCCTGTTCTGAGGTCCAAACAGATCCTAGTGA
TTCAGTCAACAAACTGATAGACAAAATTGAGAGTCTGAAG
GCCTGTGAACTAGGCAGTGACAAGGGTCCCAACAATGTAG
TCTCTTCTACCCCTGATGTGGTGCAGGGAGAGAAATTGAC
CCGTTTAAACGAAGACTCTAATTTGGAGGTTGCCACTAAA
GAATGCAAGGAGGATCCGGTCACAAGGCCCACAACCTACA
GTGACTCAGCATATGATGCAGAGTCTAGCCAGGGTAGATT
GGATGAATGTGTGTTCTCAGATGTGCTGCCCCTTGACAGT
TCCTCTGTCCATGAGGAGGAGGAGGAAGAGGAGAAAGATG
TCAATGAGGAAGATGAACCACAGACTGTTGCTGATGAAAT
ATGCAGCCAAAATGAAATGTCTGCGAGTACAACTAGCAAT
GTGTTCTGTAGTGGTGTTCAAAGCATTGCAGATCCAACAG
AATGCCACGATTTGGAGAAACTAGGTGATGAGCAGAAGCA
GGATATCCCATCTGCGGATGCTGCTGCAGTTATAGAGCCT
CTTATAAGTCTTTCTGAAGACTTTGACCTGCCATATCAAA
TCCTTCGCCTGCCCTGCAATAAGACAACAACTGGCCTCAG
TCTTGAACGAGAGATTGACCCACTTGTCTACTTTGATTCT
CCATCCACTCTGTTGCCCCCACAAAACTATTTGTCCTCAA
TTGGCAGTGCTTATTCCTACAGCTACTACCCACAAGTGAC
CCAAGAGCGCCAGAGTGTCTTAAGTCCATCCATAGATGAG
CTCTCCTCCAGAGATGAAATGTTCTCCACTGATGTAGAGG
ATCTCGAAGTTGTTCCAGGGCATGTTTATGTTGGTGGTGG
TAGGCTGGCAGAAGCCAGTGACATGCCAGTTCGCTCCCGA
AAAGAGCTCCCAAGTGTAGATAAAACTTGCTCTGTTTGCC
AGAAAACATGTGCATGCTGTGGTTCGACCTTGCAGGATGA
GGTAGGAATGTGTAAAATGGCCGAACACAGCCATCCTGAA
AGGGATGAGATGTCAGATCAAGACTGTGATTATGACCTCG
AAGCAGAGGTTCGGAGCAACTGCGAGTCTCCAAGAGTGTC
CAAAAGGAAGTGTTGCAGTAGGCATGCGCTGCCCTCTTGT
GGGCATCATTGTGCCAAACACAGACACAGGAAGCTGCTTT
GTGAAGGCCAGGAGAGCTGTGATCTACGTGAGCAGGCTCG
AGTGCATCCCAAAGGAGAGTGCTGTGAGGAGTATGGTGCT
CTGGCTAAAGCAGATAAGAGAATTCAAAAGGGTGCCTTGT
GCAGGCCTTGTATTGAGCAACAATGGAGAGAGGGGGTTGT
GTCTGACCAAGAGAATTGGGCGAGCTGTGGTGCCAAACCG
AGGTCTTGGAGGCAAGTTACTGGACCTCAGGATCAAGGGA
GAACTCCATTGAGAAGGTCGACTTGTAAATCAATCCACCA
GCAAAGGCCAAGAAGTGAATACAATGACTATGATGAGACC
GAATTTACCTACTGCCAGAGGGGCAGAGGTTCTATGAAGA
AAAGAGGCTCAAGATACTAAACCATTATGCACTGCTGTAA
TACTTAATGTATTACCCTAAACTTGTGTAAAATGCACTTC
ACTATAAATGTACACATGGACACTGTTCTTGACTGTATGT
AAATGAAAGGTATGACAGTGATGTACACCTTGCTGCATTT
CCAGTGCTCAAGTTAACTTTTTTTGGGTGCTGTGCATTCA
TCTTAATATTATGCTGAAACTGGTCTCACTGTACCAGACC
TTGACCTATGCCTACAAGGCCTTTCTAATGTGTCTTGATC
TGGGAGGTGTAGATCATTTCTGAAAAAGGGGCTCTTTGCA
TAATCAAGGACTGGCTCATTGAGACCAATTTCGAATGTTG
GTCATTGGAGATGCAGCTGGTTCAAGGGGTGATGCAGGGA
AAGATGGGGAAATTAAGTGGACAATCTGGCTATTCGGCCT
CTTAGTTCAGATGTGTCTTTGTTTTTATTACTGTGCTGTT
TTATACATCAGTGTAATGTTAACATGCAGAAAAATAAATT
TGGCTATACAGTGTTGTGTCATTAAAGTTTCCGCATTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations