Transcript

si:ch211-250e5.2-201

ID
ZDB-TSCRIPT-110912-247
Name
si:ch211-250e5.2-201
Previous Names
  • dkeyp-98a7.1-001
  • si:dkeyp-98a7.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052160 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052160|OTTDARG00000036597|ZDB-GENE-050208-519 si:dkeyp-98a7.1|OTTDARP00000041000 DKEYP-98A7.1-001 LG_ BX649337.10 Danio rerio protein_coding KNOWN, 941 bp
AAGTGTGACAGACCAGTCAGGTAATTCAGGAAGAGATATT
CTACTTGAAGCAATAGTAGCACAGCATGATGGCTGTTAAA
AACGTCTTTCACAGTTTGGCTCAAGATGGAGGTTTCTACA
TTTGTCACATTAAAAAGGCCTTCGTACTACTGCTCACATT
GGCATTCTTGTTGTCTACAATTGCTTATATGTCTGATGTC
TCTTTTGAGGACATTAAGCTACCTCATAAATGGCTTTTTA
AAGTCATAAATAAGACTCACGGGGTATTTAATCAAACTTT
GGATGACGGTAAAGACCGCTTAGCACCATTGGCCAAGCAA
CAAATTCAGCAATGGGGCGCAGCTATCTATCATGTGGCTC
ACCCAAGGAATTATGATTTCATGCTGGATGAACCTGATGT
ATGCAAGGAGAATCCATTCCTGGTCTTGATGGTTCCTGTT
GCTCCCAATCAGATAGATGCTCGAAACGCCATCCGGAGCA
CATGGGGGAATGAAACCACAGTCCAGGGGAAAGCAGTGTT
AACTCTGTTTTTGGTGGGTTTGATTGTAGGAGCAGACTCT
GAAAAAGCTCAACAGCAGCTGGAGGAAGAGAGCCGACAAC
ACAGAGATTTAATCCAGAGCAACTTTGTGGACTCCTATTT
CAACCTGACCATAAAGACCATGGTGATCATGGGCTGGTTG
GCCACTCGATGCCCTCAAGCGAATTACAGCATGAAGATCG
ATTCAGACATGTTCTTAAATGTTGATAACCTGGTGACTCT
CCTATCAGCTCCCAATACACCCAGAGAAAACTACATCACA
GGAATGGTGATGTGGAACCGGCCTGTTGTCAGGAGCAAAG
ACTCAAAATGGTACGTCTCAGAGGAGCTTTACCCCGAGCC
AACATACCCTACGTATCTTCTGGGAATGGGATATGTTTTC
TCTAATGATCTGCCATCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations