Transcript

nap1l4a-201

ID
ZDB-TSCRIPT-110325-909
Name
nap1l4a-201
Previous Names
  • nap1l4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015492 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015492|OTTDARG00000013075|ZDB-GENE-030131-9099 nap1l4a|OTTDARP00000013160 nap1l4a-001 LG_ CU024870.3 Danio rerio protein_coding KNOWN, 2078 bp
GCACTTCTCCGACTGCTGAAAACGTGAGGACAGTCTGGAG
CCTAACGTGTGGCTGAGGAGTGAAAATGGATAAAAAAAAT
GAAAAGGGCGAAGCCAGAGGTAAAGGTGGAACTAAACCAG
ACAAACCTGAGGCCTTTTTACAAGTAGAAAGAGTACCCAA
TTTCAATCTCCTTCCCAAGAATGTAAAGAGAAGAGTTTAT
GCCCTCAAAAGACTCCAGCTCCAGAGTGGCAACATTGAGG
CAAAGTTTTACGAAGAGGTTCATGAGCTAGAGAGAAAGTA
TGCTGGACTCTACCAGCCCATCTTAGACAAGAGACGGGAG
ATTGTGACTGGTGCTGTCGAACCTACAGATGAGGAATGCG
AATGGCACAGCGACAAAGAGGAGGATGAGCTTGCTGACGA
TTTGCAAAAAAAAGCTGCTCTGGAGGAGAAGCAGGCAGAT
TCAGCCAGTGCCGTTGATCCGAAAGGAATCCCCGATTTCT
GGCTTACAATCTTTAAACATGTGGATATGCTGGGAGAAAT
GCTGCAGGAACATGATGAGCCAATCCTAAAACACTTGCAG
GACGTCACTGTGAAGTTTTCTGAGCCTGGACAGCCAATGA
GTTTCACGTTAGAGTTCCACTTTGAGCCCAACAGCTACTT
CAGTAACACAGTCCTCACTAAAGTTTACAAGATGAAATCA
GAGCCGGACGCAGCCGATCCGTTCTCTTTCGAGGGGCCAG
AGATTGTGGACTGTGAAGGTTGTAAGATTGACTGGCATAA
AGGCAAAGATGTGACAGTCAAAATTGTTAAGAAGAAGCAG
AAACACAAAGGAAGAGGGACCATTCGAACAGTTAGCAAAG
AGATCCCACAAGATTCATTCTTCAACTTCTTCAATCCAGT
TAAAGCCTCACCTGATGGAATGGATGAAGACTTGGATTTC
ACTCTAGCTACGGATTTCGAGATCGGACACTTCTTCCGAG
AGAGGGTTATTCCCAGAGCAGTGCTTTATTTCACAGGAGA
GGCCTTAGAGGATGACGAAAGTTTTGAAGAGGAAGATCTT
GAAGAGGGAGAAGAGGAGGACCTGGATGAGGAAGGTGAAG
AAGAGGAGGAGGGTGATTTTGACCCCACGGCATAATTCAT
TACTCAATTCATGCATTTCTAGAAAGACCCTCCTCCTGCA
GAGTGCAAACAGCAGTAAGACTCAAGAACAGACAGCCATG
GCACAACTCGGCTGCTGTCAGCCAATTAGACGGTGTGGAT
GCAAACCTAATTTCCTCGTGGACTCGCAACACTAATGCAA
TAGGAAACCAAACGCTGTTTAGAAAATGCATGTTTTCTGT
ACTGTTTACTTTTTACAGAGATGACCTCAGTGTTTTCGTT
CATAAGACGTGTGATATCACACTCTGAAATCTAGCCGACA
AAACGTGTAATGTAATGATTTTCTTTCGGAAGAAGTTTCT
ATGTTCAAAATGTTTGTCTGGAGCTGGTGTGTGAGTGAGG
GCAAGCAAAGACACCCCTTGTATTTTGAATTCTTAACATT
CATATGCAACCATTACCATTTTTGCAACATAGCAGGTTCT
TGGACACTCCCTAGATGATATGACCTCCCAAATGGCGTCC
AGTGTAGCATCACTCAGGGTTTTTCTTTGCCAACAATTTG
AACCTGCTGCGTTTATGAATTTGACATTCGCTGAAATTTC
CAGTTTCACTGTTACAGTTTAGTTAAGAAGTGTTTTGAAA
CTGGAAGCTGAACGATGTGGATTATGGTAATAGAATACTT
ATGGTTTGAATTTAGGGTTGGGTGTCATTGAATTCCCAAA
TACCTATGTGACGTACTGCATATCCATGCCATGCACGTTG
ACACAGGATTTCTACCATATTTTATTTCGCCATGTGATTA
CGTGTCGAGTTGCTCGATTCATGCACAGAGTTTCATCTAT
TACAGTATTAAGAATGTTAACAGCGGGTCTATCCTCCTCT
ATTTTGAACTGTGTGCAAGCCTTAGCCTTATCTGGAACTT
TTTCGGGTTGTAATGCAACATTGTTTCCATTTTGTACAAA
ATAGACAAAAATATTATATTAAATGTTGTGGGACATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations