Transcript

elk3-202

ID
ZDB-TSCRIPT-110325-904
Name
elk3-202
Previous Names
  • elk3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008195 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008195|OTTDARG00000007274|ZDB-GENE-030716-2 elk3|OTTDARP00000007229 elk3-001 LG_none BX649411.10,BX537336.19 Danio rerio protein_coding KNOWN, 2275 bp
GTCAGTGCGCTCCTCTCGCTGCAGATTCGGGTTACAGTAT
AGCCTATGCTGAGTGTGTGTGTATGTGTGTGTGCGTCCGC
ATCCGCGTGTGTGCTCGTGTTCCTGAATGTCGGATGGTGG
CTAGAGGAGGAAAAGCGTGTTTACACAGACGGGCCGAGCG
CCTGGGGAATCGCGCACGGCGAGAGGAAGTGAGCCGGCTC
GCTGTCTGCCTGCTGCAACTTCCTGCTCACAGAGAGAGAG
AGAGAAAGAGTGAGTGAGTGAGAGAGAGAGAGAAAACAGT
CGGGATCCCATTACAGTCCGACTGAGAGCTGCCGAGACGG
CCGACAGCATGGAAAAACAGCGCATTATACGGAATTCTTA
TTAATAAAGTGAAAAGGGAGCCCGAGCATTACGCAGAGAT
ATGGAGAGTGCTATCACGCTGTGGCAGTTTCTGCTGCAGT
TACTGCTGGATCAGAGCCATAAGCACCTGATTTGCTGGAC
GTCCAACGACGGCGAGTTCAAGCTGCTGAAGTCAGAAGAA
GTCGCCAAACTCTGGGGCCTGCGCAAAAACAAGACCAACA
TGAACTACGACAAACTTAGCCGAGCGCTACGCTACTACTA
TGACAAGAACATCATCAAGAAGGTGATTGGTCAGAAGTTT
GTGTACAAGTTCGTCTCATTCCCTGATATCCTGAAGATGG
ATCCCCAAGCAGTGGAGCTCGGTCGGGATGGGGGTCACGT
CGCAGGGGGCGTCATGTTACAGGATGTGGAGTCAGACTGC
GGCGAGGGGGAGGAGTCTCCAAAACTGTCGCTGTCTTCGC
TGCGAAGCCCCGCCTGTAGGAACGAGTATCTTCACTCGGG
TCTGTACTCGTCTTTCACAGTCAGCTCCCTTCAAAACCCG
CCTCCACTGCTGCGTCCAATCAAAGTCGAGAACCAGCGAG
GGTGCGAGCGAGGGGAGGAGGGACAAACGGTGATTCGATT
CGTCACTAATCGATCAGAGAAAGCCATTCCCCTTGCTTCC
TCGCCTCCCCCTTCATCCGGAGAAGTCTTCTTCACTTCCA
AATCCTCCCCGTGCTCTTCCCGAAGCCCCTCTCCTTCCCA
TAGCCCTGTCTACACGCTGCGACATGGGCAGAGCCCAGAG
GCTCGCATAGACGAATCAGAGCCCAGCGCTCAGCCTTTAA
ATTTATCTTCCAGCCACAGGGAGCGAGCCCAGAATCAGGC
TTCGCCCCTCGAGAGGAGGACCAGTAGCAACAGACTGCCT
CCGAAAGCCCGGAAACCCAAAGGGCTGGAAATCTCCGCCC
CTTCAATACTGCTTTCAGGAAGTGACTTGGGCTCCATCGC
CCTCAACAGCCCAGCACTGCCCTCAGGGTCCCTTACGCCA
GCCTTTTTCACTGCACAGACTCCCTCCGGTTTGCTGTTGA
CGCCCAGTCCTCTCCTGTCCTCCATTCATTTCTGGAGCAG
CCTGAGTCCCGTGGCCCCCCTCAGCCCCGCCAGACTACAG
GGACACAGCTCACTCTTTCAGTTCCCCTCCCTGCTGAACG
GCCCACTTCCAGTTCCCCTGCCAAACCTGGACTCTCCTTC
ATCCTCCTCCTCCTCCTCATCATCCTCTTCCTCTCTCCTC
TTGTCCTCCAGCGGGCAGAAATCCTGATTCCTGCACACAC
AAACACACACACACACATACAAACACAGACTTGTTCCTAT
ATCCCAGTGGGGACTCTCACAGACCTAATGATGTTTATGT
TTATGACTATACAAACCGTATATTCTCTCATCTACCCCTA
AACCCAACCCTCACAATACTTCATTCTGTGCGATTTACAA
GCACGTTTACCTATCGTTTGGTCCACACAGTGACTATGAG
TCAGTTTTAGATCACTTTTATATCCCCGCTGGGATATAAA
CACAAGTACACACACACACACACCTACACTAAAGCAGGAC
TGAAGGATGGAGCTTGATGTTTTGTGTTGAGCCAGACTGC
ACTTCTCCCCCTTGTGGCCACTTCAGTCACTGCAGCCTGC
ACTTCAGGACACAGTGTGTTTATTTTTTCTGCAATTCAAA
AAAGCAAGCTCTTAAAGACAGGATTATTATGAGGTGAAGC
CAAAGAACATCAAGTGTCCTTTTGAGAAGACTTTGAGTCA
TTGGAAACGGAGCCGCAGAGCCTCTTTGAATGGAGAAACG
GACATTTAAGGCAAGTTATAATTCAAAAGCCTCTTCTGAT
GGGAGAAGCGATGCTGGACGATGTGTTTTATTCAGCAGAC
CTCCATTAAAATTGACGCTAAATTACAAGCGGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations