Transcript

slc17a6a-201

ID
ZDB-TSCRIPT-110325-768
Name
slc17a6a-201
Previous Names
  • slc17a6a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050562 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050562|OTTDARG00000035523|ZDB-GENE-050105-4 slc17a6a|OTTDARP00000039697 slc17a6a-001 LG_ CR762436.8 Danio rerio protein_coding KNOWN, 2608 bp
AGTTTCAGCCCTTTTCTATGGTGATGGAATATTCTCTATA
ATAAATATGTGGAGAAAATGGATAAGCGAGGAATCACAGA
AGTCGTCGGAAAGGGAGTTTCAGAGGACATTCCAGTGAGA
TTTCGATTGATTGAGTGTTTTATAGGTCGCCTGTAAGGAG
TATATACGCAAAAAATATATATACCAGGTCGAGAAATAGC
CTACTGCTCAGGATTGCACACTCAAGGAATATGCTGAAAC
ACCTCACAGCTGATTCAAGTTAAAATATTTCTTATTAATA
TCGAGTGGATTATTATCTCTGGCGATGGATACAGTGAAGG
AGCGAGTTTTGGCACCCGGCAAGGAGAAAATGAAGAATCT
GGCCGGGAAAACCCTCGGACACATGCACAGGGTGATGGAG
AGGAAGCAGAAGACGGGCGAGGTGATCGAGCTGACGGAGG
ACGGGCGGCCCATGCACATGCCGGAGAAGAAAGCGCCTCT
GGTGGACTGCACGTGCTTCGGGCTCCCGCGCCGCTACATC
ATCGCCATCATGAGCGGCCTCGGATTCTGCATATCGTTCG
GGATCCGCTGCAACCTCGGAGTCGCGATCGTCGACATGGT
CAATAACAGCACCATCCACAAGGGTGGCAAGATCATCATC
AAAGAGAAAGCGAAGTTTAACTGGGATCCGGAGACGGTGG
GGATGATCCACGGCTCGTTTTTTTGGGGCTACATAGTAAC
ACAAATCCCAGGAGGATATATTTCGTCACGACTGGCTGCC
AACAGGGTGTTTGGTGCTGCGATCCTGCTCACATCAACCC
TCAACATGTTCATCCCCTCTGCTGCGCGTGTGCACTACGG
CTGTGTGATGTTCGTGAGGATCCTGCAGGGCCTCGTCGAA
GGTGTGACATACCCAGCATGCCATGGGATTTGGAGCAAGT
GGGCTCCACCACTTGAGAGAAGTCGTTTAGCAACCACCTC
TTTTTGTGGCTCATACGCTGGCGCTGTGGTGGCGATGCCG
CTGGCTGGAATATTAGTGCAGTACTCAGGCTGGTCTTCCG
TCTTCTACATTTATGGGAGTTTTGGGATCGTCTGGTACAT
GTTTTGGATTCTGGTTTCATACGAGAGCCCGGCGGATCAT
CCCACCATAACAGATGAAGAGAGGACTTACATCGAGGAGA
GTATTGGAGAAAGTGCCAAACTTCTGGGGGCCATGGAGAA
ATACAAGACACCCTGGAGGAAGTTCTTCACCTCTATGCCG
GTCTATGCAATCATCGTGGCCAATTTCTGCAGGAGCTGGA
CCTTCTACCTGCTTCTCATCAGTCAGCCGGCGTACTTCGA
GGAAGTGTTTGGCTTCGAGATCAGTAAGGTCGGTATGGTC
TCTGCTCTCCCTCACCTGGTCATGACCATCATTGTGCCAA
TCGGTGGACAACTGGCCGACTATCTGCGCAGCAAAAACAT
CTTAACCACCACCACCGTCAGGAAAATCATGAACTGTGGA
GGGTTTGGCATGGAGGCCACTCTGCTGTTAGTGGTGGGCT
TCTCTCACAGTAAAGGTGTCGCCATCTCTTTTCTGGTGCT
CGCTGTTGGCTTTAGCGGCTTCGCTATATCAGGGTTTAAT
GTCAACCACTTGGACATTGCGCCACGGTATGCCAGCATAC
TGATGGGTATTTCTAATGGGGTCGGCACACTTTCTGGTAT
GGTCTGCCCTCTGATTGTAGGTGCTATGACCAAAAATAAG
ACTCGTGAAGAGTGGCAGAACGTGTTCTTAATCGCGTCGC
TGGTTCACTACGGCGGTGTGATTTTCTACGGGATCTTTGC
ATCAGGCGAGAAGCAGCCATGGGCTGATCCGGAGGAGACC
AGCGACGAGAAGTGCGGCTTCATCGATGAAGACGAGTTAG
CAGAGGAGACGGGCGACATCACGCTGAGCCACGCTCCTTT
CGGGGCCCAAGGCGCTCTTGGGGCCCCGGCCAAAACATAC
GGGGCCACAACGCAGCTGAACGGAGGCTGGGCGAAAGGCT
GGGAGAAAACCGAAGAGTTCATCCAGGAGGACGCAGAGCG
CACCTATACTGGAGACGGGTACTCGTAGATACATTCACTA
AAAAACTAAATATATCTATAACAAAACAATACAAGGGGAG
AGAAACTATCCACCTTTTTCCTATGATGCTGTGTGCAAAT
TGTGGGAGTATCTTCTGTTAAGCTCGTAAAACATACTATA
GTGATTTAAAGTAACCATTCTACAGTAAAGTACTTGGCTG
CATCCGAATTCACATACTTGCATACTATAAAGTACGTTAA
AAACCGTATACGAGCCGAGCAGTGTGCCCAAATTCAAAGG
ATTTAAAAATACAGTATGCAAGAAGTACACTACTTCTGGT
GAGATTCTGAAGTGCACATCCAATGGACGCTACGTTATCC
CATGATGCAAAGTGAGATGTATGAATGGGAGTGAATAGGT
CATGTGACATTAACTAATGGTGGATGTAGTACGTTTGAAT
TCCATTCGTACTATATAGAAGACACTATTAAAACAGTCGT
GTAGTAAAGTCTAATTCAAGTGCAGTACATACTTGAGTAG
TAGGCGATTTCTGGCCCTTTAAAGGTCCAGTGAAATTAAA
CGTTTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations