Transcript

kif11-002

ID
ZDB-TSCRIPT-110325-584
Name
kif11-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049702 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049702|OTTDARG00000034982|ZDB-GENE-020426-1 kif11|no_translation kif11-002 LG_ CU571091.4 Danio rerio protein_coding KNOWN, 799 bp
GTGTGCATGCAGTCTGTGGAGGAAAAGGGTGAGAAAGCTG
TTCAGGACTGTGAAGCCAGATTGGGTCAAATGCAGCAGGA
AATGGAAGCAACCCTGGGTCGTGTGGAAATGCAGACCAGC
AAAGATGAAGCGACATTGCAGGAGCACAGAGAGACCCTGT
CCTCCATCAACACTCAGGCACTGGACACCGTACACAACTT
TATCAGCTCAGAGCTACGGCAGGATTTACCAACAGGAACG
ACCCCTCAGCGCAAAGAGTACATGTACCCACGTGTGCTGA
GCAGGCCGAGGAGTAGAGAGGAGCTGGAAGAGGAGTTCAG
AGCTCAGCAAGAGCAGCTTCAGTCTGAACTGAAGCCGTGT
GAGATCGTAATGGAGGTGGAGGAGGAGAAACCTGTCGACC
AGGACTCTCTGGAGGATGACGTCAGTGTTTCTAGTGATGG
AAACAACACTGAACAGTCGTGCTCTGATGAGAACCTGATA
TGTTATGAGAATGGAAGGATTCCTTTTTTCAAGAAGAAAA
GCAAGAAGGAAAATGGCAGTAAATCACTGAACCGTTCAAA
GGTGGAGAATGACAGCATGTCAACACCACCCCGCTCTAAA
CTTCCACTCAGATGTCAGAATTAACCTAAATTATGTTGCC
AATATTACTCCCTTCGTGTATTAATCTTCCAAGTCCTTTT
GTGTCTTAAACGTTGCATTTTTTTAACTATGTCTTTTTTA
AACATCGATTATCAATGTATTTGTCTTATGTCTGTCCACA
CAAGTCAGTTATAACTTCAGGGTGATTTCGTACTGTTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations