header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-35
Transcript Name: drd1b-201
Previous Names: drd1-001, drd1b-001, ch211-79h18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034584 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034584|OTTDARG00000026128|ZDB-GENE-070524-2 drd1b|OTTDARP00000027868 CH211-79H18.1-001 LG_ CT998556.5 Danio rerio protein_coding KNOWN, 2043 bp
GCTTAACCTCTTTCGGAGAGTATGCTGTGGGACGGTGAAC
AAACTGCTGACAAGGTCTGTGGGAGTACATGGATCCATTT
TTGAGCTCCTCGAGAGATTTTAACATTGAAAATATGATAT
GTGCTTTGCAAGATGACTCCAGCAGTCAGCATAACTACGG
ACAAACCAGATCAACCAGTTGCTCCGATTCACGTGTAAGC
ACTCTTAGTTTGGTCTGGAATTATGGGGTGACTGCTAACT
CGACTCGGTGAAAAGCCATGGATGTGAATTACTCCACAGT
CCTGGACAGCAGTGTGTCGCAGCGCGATTCATCAAAGCGA
GTTTTGACTGGTTGTTTCCTCTCACTCCTCATTCTGACCA
CCTTACTGGGAAACACGTTGGTCTGTGCTGCAGTCACAAA
GTTTCGCCATCTGCGCTCTAAAGTCACCAACTTCTTTGTT
ATATCACTGGCTATTTCTGACTTGCTTGTGGCCATTTTGG
TGATGCCATGGAAAGCCGCCACGGAGATTGTAGGTTTTTG
GCCGTTCGGCGCCTTCTGCGATGTTTGGGTGGCCTTTGAC
ATCATGTGTTCCACTGCCTCCATCTTGAATCTGTGCGTCA
TCAGTGTGGACCGCTACTGGGCCATTTCAAGCCCGTTTCG
CTATGAGCGAAAGATGACACCAAAGGTGGCGTTCATCATG
ATAAGCGTGGCATGGACGCTGTCCATCCTTATCTCCTTCA
TCCCTGTGCAGCTAAATTGGCACAAAGCCCAGACGACTAG
TTATACAGAGCTTAACGGTACCTATGGCGAACTTCCCCCA
GATAACTGCGACTCCAGCCTTAATCGGACATACGCCATCT
CCTCCTCGCTGATTAGTTTTTACATACCTGTGGCCATTAT
GCTGGTCACTTACACCCGCATCTACCGCATTGCCCAGAAG
CAGATACGTCGGATCTCGGCGCTAGAAAGAGCTGCTGAGA
GCGCAAAGAACCGCCACAGTAGCATGGGAAACAATGCCAG
TATGGAATCTGAAAGTTCTTTTAAGATGTCTTTCAAACGT
GAAACCAAAGTTCTCAAGACCCTCTCGGTCATCATGGGTG
TTTTCGTGTGCTGCTGGCTGCCCTTTTTTGTTTTAAACTG
CATGGTTCCTTTCTGCAACCCAAACGAGAGCACTGACTTC
TTGTGCATCAGTTCCACCACATTTGATGTGTTTGTTTGGT
TCGGTTGGGCGAACTCATCACTCAACCCCATCATCTATGC
CTTCAATGCTGACTTCCGAAAGGCATTCTCCATCTTGCTG
GGCTGCCATCGGCTCTGCCCGGGCAGCAGCGCTATAGAGA
TTGTGAGTATCAACAACAACTGTGGCCCTCCGTCTACTTC
TCAGTATCAGCCTAAGGGCCACATTCCCAAGGAGGGCAAC
AACAGCAACTATGAGATCCCTCACAGTATCATATGCCAAG
AGGAGGAGAACCAGAAGAAGGAGGACGACTCTGGCATAAA
GACCTTTGATAAACTGTCACCTTCCATGTCAGGCACTTTG
GATAGTGATGCGGACGTCTCACTAGAAAAGATCAACCCCA
TTACACAAAACGGACAGCACAAATCCATACCCTGCTGAGC
AGCGGGTGAGATCTGACTCCAGCAAGGAATCCTTGTTTAT
ATACAGTACAGAATCCAAAAGCTTCACTGAGGACCTTAAT
AACAATTTTTGGACTTAACGAAACTTGTGGAAAACAAAAG
AATGTTCCAATCGAAGGCACTTTATGCTGGATAACTATCT
GCAAAATTTTCACAGCATTTATTATTGACATTAACAGGTC
AGTTGTTGCAAAACATCTACGGAAAGTAATGCGAACAAAC
GATGCGTGCATATGCATACATGTGTATACATATGCACGCA
TGTGTGCTTGAACTATACTGTTGTTAATATAAAGACAAGA
GTTAGGTCTCTAGTAAAATATCTTGTAGGTGAGTTCACTT
TAACGGCTCACAAGTAGAGAAATTTGGTCGTGTCTACTCT
GTCGACAATAAAATGTACATAGCGTTGTTTAAATTTTTCA
CCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
drd1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034584 (1),  Ensembl_Trans:ENSDART00000056810 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:FJ208849 (1) 2063 bp
GenBank:AL914058 (1) 522 bp
GenBank:AL914057 (1) 513 bp
CITATIONS (2)