Transcript

drd1b-201

ID
ZDB-TSCRIPT-110325-35
Name
drd1b-201
Previous Names
  • drd1-001
  • drd1b-001
  • ch211-79h18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034584 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034584|OTTDARG00000026128|ZDB-GENE-070524-2 drd1b|OTTDARP00000027868 CH211-79H18.1-001 LG_ CT998556.5 Danio rerio protein_coding KNOWN, 2043 bp
GCTTAACCTCTTTCGGAGAGTATGCTGTGGGACGGTGAAC
AAACTGCTGACAAGGTCTGTGGGAGTACATGGATCCATTT
TTGAGCTCCTCGAGAGATTTTAACATTGAAAATATGATAT
GTGCTTTGCAAGATGACTCCAGCAGTCAGCATAACTACGG
ACAAACCAGATCAACCAGTTGCTCCGATTCACGTGTAAGC
ACTCTTAGTTTGGTCTGGAATTATGGGGTGACTGCTAACT
CGACTCGGTGAAAAGCCATGGATGTGAATTACTCCACAGT
CCTGGACAGCAGTGTGTCGCAGCGCGATTCATCAAAGCGA
GTTTTGACTGGTTGTTTCCTCTCACTCCTCATTCTGACCA
CCTTACTGGGAAACACGTTGGTCTGTGCTGCAGTCACAAA
GTTTCGCCATCTGCGCTCTAAAGTCACCAACTTCTTTGTT
ATATCACTGGCTATTTCTGACTTGCTTGTGGCCATTTTGG
TGATGCCATGGAAAGCCGCCACGGAGATTGTAGGTTTTTG
GCCGTTCGGCGCCTTCTGCGATGTTTGGGTGGCCTTTGAC
ATCATGTGTTCCACTGCCTCCATCTTGAATCTGTGCGTCA
TCAGTGTGGACCGCTACTGGGCCATTTCAAGCCCGTTTCG
CTATGAGCGAAAGATGACACCAAAGGTGGCGTTCATCATG
ATAAGCGTGGCATGGACGCTGTCCATCCTTATCTCCTTCA
TCCCTGTGCAGCTAAATTGGCACAAAGCCCAGACGACTAG
TTATACAGAGCTTAACGGTACCTATGGCGAACTTCCCCCA
GATAACTGCGACTCCAGCCTTAATCGGACATACGCCATCT
CCTCCTCGCTGATTAGTTTTTACATACCTGTGGCCATTAT
GCTGGTCACTTACACCCGCATCTACCGCATTGCCCAGAAG
CAGATACGTCGGATCTCGGCGCTAGAAAGAGCTGCTGAGA
GCGCAAAGAACCGCCACAGTAGCATGGGAAACAATGCCAG
TATGGAATCTGAAAGTTCTTTTAAGATGTCTTTCAAACGT
GAAACCAAAGTTCTCAAGACCCTCTCGGTCATCATGGGTG
TTTTCGTGTGCTGCTGGCTGCCCTTTTTTGTTTTAAACTG
CATGGTTCCTTTCTGCAACCCAAACGAGAGCACTGACTTC
TTGTGCATCAGTTCCACCACATTTGATGTGTTTGTTTGGT
TCGGTTGGGCGAACTCATCACTCAACCCCATCATCTATGC
CTTCAATGCTGACTTCCGAAAGGCATTCTCCATCTTGCTG
GGCTGCCATCGGCTCTGCCCGGGCAGCAGCGCTATAGAGA
TTGTGAGTATCAACAACAACTGTGGCCCTCCGTCTACTTC
TCAGTATCAGCCTAAGGGCCACATTCCCAAGGAGGGCAAC
AACAGCAACTATGAGATCCCTCACAGTATCATATGCCAAG
AGGAGGAGAACCAGAAGAAGGAGGACGACTCTGGCATAAA
GACCTTTGATAAACTGTCACCTTCCATGTCAGGCACTTTG
GATAGTGATGCGGACGTCTCACTAGAAAAGATCAACCCCA
TTACACAAAACGGACAGCACAAATCCATACCCTGCTGAGC
AGCGGGTGAGATCTGACTCCAGCAAGGAATCCTTGTTTAT
ATACAGTACAGAATCCAAAAGCTTCACTGAGGACCTTAAT
AACAATTTTTGGACTTAACGAAACTTGTGGAAAACAAAAG
AATGTTCCAATCGAAGGCACTTTATGCTGGATAACTATCT
GCAAAATTTTCACAGCATTTATTATTGACATTAACAGGTC
AGTTGTTGCAAAACATCTACGGAAAGTAATGCGAACAAAC
GATGCGTGCATATGCATACATGTGTATACATATGCACGCA
TGTGTGCTTGAACTATACTGTTGTTAATATAAAGACAAGA
GTTAGGTCTCTAGTAAAATATCTTGTAGGTGAGTTCACTT
TAACGGCTCACAAGTAGAGAAATTTGGTCGTGTCTACTCT
GTCGACAATAAAATGTACATAGCGTTGTTTAAATTTTTCA
CCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations