Transcript

roraa-202

ID
ZDB-TSCRIPT-110325-2657
Name
roraa-202
Previous Names
  • roraa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050900 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050900|OTTDARG00000035739|ZDB-GENE-060306-2 roraa|OTTDARP00000039974 roraa-001 LG_ CU468885.14 Danio rerio protein_coding KNOWN, 8182 bp
CTCAAATCGAAATAATTCCCTGCAAGATCTGTGGAGACAA
ATCATCAGGCATCCATTATGGCGTGATAACGTGCGAGGGC
TGCAAGGGCTTCTTCAGGAGGAGTCAGCAGAGCAATGCGG
CGTACTCGTGCCCGCGTCAGAAGAACTGCCTGATTGACCG
CACCAGCCGGAACCGCTGCCAGCACTGCAGGCTGCAGAAG
TGTCTGGCCGTGGGCATGTCACGTGACGCGGTGAAGTTTG
GCCGAATGTCAAAGAAACAGCGGGACAGCCTGTATGCGGA
AGTGCAGAAACACCGGCTACAGCAGCAGCAGCGGGACCAC
CAGCAGCAGCCCGGTGAAGCCGAACCCCTTACCCCAACTT
ATGGCCTCTCCACCAATGGTCTGACCGAGCTCCACGATGA
TCTGAGTGGATACATGAATGGCCACACGCCGGATGGCACC
AAGCCTGACTCAGGAGTCAGCAGCTTCTACCTGGACATCC
AACCCTCACCTGATCAATCCGGCCTGGACATCAATGGCAT
CAAGCCAGAGCCCATCTGCGACTTTACCCCTGGCTCAGGC
TTCTTCCCCTACTGCTCCTTCACCAATGGGGAGACGTCCC
CCACCGTTTCCATGGCTGAGTTGGAACATCTGGCCCAGAA
CATTTCCAAGTCCCACATGGAGACGTGTCAGTACCTGAGA
GAAGAACTTCAGCAGATGACCTGGCAGGCGTTCCTTCAGG
AGGAGGTGGAGAACTACCAGAGCAAGCCCAGGGAAGTCAT
GTGGCAGTTGTGTGCCATCAAAATCACAGAGGCCATTCAG
TATGTGGTGGAGTTTGCCAAGCGCATCGACGGCTTCATGG
AGCTCTGTCAGAATGATCAGATAGTGCTTCTCAAAGCAGG
CTCTTTGGAGGTGGTGTTCGTCAGAATGTGCCGTGCCTTC
GACCCTCAGAACAACACAGTCTATTTCGATGGAAAGTATG
CCGGGCCTGATGTCTTTAAATCATTAGGCTGCGACGACTT
GATCAGCTCTGTCTTCGAGTTTGGGAAAAACTTGTGTTCT
ATGCACCTCTCTGAAGACGAGATCGCCCTGTTCTCCGCCT
TCGTCTTGATGTCTGCCGACCGATCCTGGCTCCAGGAGAA
GGTGAAGGTGGAGAAACTCCAGCAGAAGATCCAGCTGGCC
CTCCAACATGTTCTGCAGAAAAACCACAGAGAGGACGGCA
TACTGACAAAGTTGATATGCAAAGTGTCCACGCTGCGAGC
CCTGTGCAGCCGGCATACGGAAAAGCTGACGGCGTTCAAA
GCAATATACCCAGACATTGTCCGCGCACATTTCCCCCCTT
TGTACAAGGAGTTATTCGGATCGGACTTTGAGCAGTCGAT
GCCCGTTGACGGGTAGCATTTCCCTGCGCCCTGATGCCAC
ACCGTGGGGAATGTCAAGCTTCAATCTGAGACACTTTAGC
AGTGCCCTGCACACACACACACACATATGCACACACACCT
GGATGGACGACACACTGCACACACACACACACACTTTTCC
CCCCTAACCTTTTTTTTTTTTGGCCATTTTTTTTTCGTCA
GGGAGATGATGATAATGGACTGGGTAGGACTCCAGCGGTT
TATTTTTGGGGGTTTGTTCCCTCTTACTGACACAGGTGGG
ATTCGGAGCCCAGGGGAGAGGACGAGAAGATGAAGACACT
TTTTTTTTTTTTTCCTTCTCTCTCTCTCTTTCTCTCTCGT
TCCTTTCCAGAGCCGTCCCGTGGCGATTTGTCACCATCAG
CATAAATAGTTCTGACTCGTTTCCAAAACGATTCCCAGAG
AGAGCACCTAAACTTTTCGCAGCCCCTTCCTCAAGCCACG
AATGAAGTTGCGATAAAAAAAGCTGATTATCTGGACTGTT
CCAGCAGTTATAGTAGCACCAAAACAAGTGTAGAAGCATA
TGTTGTGGTTTCTTCCTTCCCTTGGATTTTAGTTTTTGGG
ATGCGAAACGAAGAAGAGAGAGAGAGAAAGAGAGATACAT
AGAAGAAGACACCTCCGAACAGCACCTTTCTACGGACAAT
CGAGGACTAAAAAAACAACAACAACAAAAAAAAGAAGGAA
CAACGTGTAGAATTCTGGTAATTCTAGTCGTAAAGCGTGC
GATTGCTTTTAGCCGTCAGAGACTCCATCTATCATAGTTG
CTTAGTGATATCGTTTAAGGCCATCTGCTATTAAGTCCCT
CTCTGGAACGGTGTTTTATCGTAACGTAACGGTCTGACCA
CAAACATCGATGCAATGCAAAGGGTCCATTCCACCTGTTT
TCTAACGTGTTACAGGGTATACGGTCATAAGTACAAACTA
TACAGAAGAAGAAAAAAAAATAATGTTTATAGAATCTATT
TTAAATAACATGTATGATATTTAGTAGCTAGACTATTCTT
AATTGTGAAAAATCGATAAGGCACTTTTATTTGCACCTTT
CTTTAATTTAAGACTTGTATATTTACCTAGTGATGTGTTG
CATGTATAAATACCACGGTTCTGGAGAGTGATTGCTGGAA
ACCCAACGCTGCTGAGGGTGGGTGCGTGTTTGCGTGTGTG
TTTGTGTATTTATTTGCGCGAGGCGGAGGTTGGTGCTGGG
GAAAGGCGGGTCATGTGATCTGGGAGTGTATAATCATTTT
TTTTTTGGTCATTTAAACTGGAACTAAGCTCTAGTTCTTG
TGAACCTAAGCACACGGGGTCTATTCAGTGAAATAAGACC
CTTTTTTTTCTCCATACGTCATTTGCTGTTTAATGGTTCC
CTCTAGTGGTGGTCCACCAGATCTGTTGGCTGATTTACTT
AAACCGACTATTGTGAGGGTCTTTGCCCAGCAACAACGCT
CGTCGGGAACGTAAGAGTGAGGAAAAAATACAAAAAGAGA
CATATTCAAAGCCTTGTCTGGTTGAAAATCCTCTATTTTT
GTAACATTGTACAGTGCTTATGAAGCCTATGAGAGAAAAA
AGGGAAAGAAAGAAGAATGATTTAGCACTTAATCCTGCAA
TAATTAGAATATGTGTGTTTTTTTAATGATTTTATTTGTC
TTTTTCGAAGAACAAGACATTTGTAGTAATAGTGCTATTT
TTCGGAAATACCTAACTGTTGTGTGTTGCGCGTGTTTGTA
CGTCTTTTGAATGTGCCATAGTGGTCTTTCCTGCTTTTTT
TTTTTTTTTGAGTCTAAATAACAAAAAGATTTGTTGTATT
GTAACATTCCAGTAAAAAAACTACTTAGAAAATCCCACAA
TAATCCAGAAGAAGGAGAAAAATAAACATTATTGATCCTC
AACCTGCTTACAGACATTCTGACAAACATCCAGTATAGAT
CTTGGTAGCTTTTGTGTCATTCCCCCCATAATTTCCTCAG
GGAAGAGTCTGTCTAACTCGATTCTGAAGCCGGTAGCTAA
AAAAAAATGTTAGTCAGCTCTATGTTACATCTAAAGCTCA
ATAATTTGATCTTGATGGCCTGTTTAGAACAAATAAATAG
CATTTTTAATATAAGTAAACCACATCACTAAACGATTAGT
CAATGCATTCCATCATGAATGACAATCCAGGTTCATGTTT
AGTTGTAAATCAGCAGTTTGTGCACTACACGGCTCAGGGA
GAGAGATGCGGTGATGATTGAGAAAACTGATATAATGCGA
TCAGTTCCAAACCTAGTGAGCTGCCTACATAGCGAAAAAT
GTGTGTTCACTACTTTATTTTGACCAAATTTGGCCGTATA
TTGCTGAAAAGCCATTCCAACATGGAGATATGAGATCAAA
AGATATGATAATTATGAATTTACGCCATTCAGCATCATAA
ATAATGACAAAATGCTGTTAATAGTGCAATATTTACCCAA
CAATTGTGGGAAATTTGCTCAATACTTAACATAGCAGCAT
ACTGATGTAAAAACTCCATTGAAATCAATTGAGAGAAGAC
ACACCGTTTGGTAAATAGGTGCCGCCTACATGACATTGTT
AAACAAACATTTATAAAAGTTGGGAAATAAAAGTGTTCCC
CCTCACTAATTTATGTTTAAATTTTAAGGCATGTGCTGTG
TCATTCTTTTAGCATAGCAACATGCTAGTGTAAAATTAAA
TTGAAATCAACTGTAAGAGAAAACAAACATGCTACATGGT
ATTTTTGTAGTGGACAGGGATGTTTTCTATGTACAATAGC
CCAAGTAATAAGGTTTTGTTGCCTATCTAGACAGCAAAAA
TGTGTTGCCAGAATGGTGAGAATTAGTAAATATGTGCTAC
ACTGATTTGCTTTTAAATTGTGTATTGCGGTAAAAAAAAA
ATCTTCCAACATGGCGTGCTAATTACATCCTATTCTATAC
TAAAAAATGTTTTTAATTTAATTTTATAGTTAATACTCAC
CCAAAGTTTATGCTTTGTGAAGCTTGTTAATGTATAATGT
GTTTAGCATAGCAATGTTAACTTAATGAAGGTTATTAAAG
TAGAATGTATTTAGCATAGCTACTTGCTAACGTAAAACCA
GCCTGATCTCACGAGAAAACGTAAGTGTTTTACGTTTTGT
CAGTTAAGTAGCTAATTCGTACGAAATTATACGATTTTAA
AAAGGAGGCGTGGCATCTAACAACCCCCATACCCCCCCTC
CCTCCATCCGTCATTGGGGGATGAGCAAATCGTACTAAAA
TGTGCAAATTAGATTGTACGAAGTCATACGAATTACCTGC
TAAATTAAAAAGTTACGAATTGCCATGAGATTGTGTTGCT
TAAAACACATTAGATATCAATTGTGAGACGAGACAAAACA
CATGTTGTGAATGTAGATTGATCTAAACCACTTCTGCTAC
GTTACATTATGCTGCCTATGTAGATAACATACAAGGCAGC
TCACTAGGAACAGAACTGAACCAAAAAAAGAACCTGGTAT
TGTGTTAAAAGTACAAATCTGTCACTGTTCATTCTTTAAT
CCTCATTTTTCATCTTTGGCAATTTCGTGCTCATGTCGCA
CCCCGTTATTCACTAGCATGAGTGCTGTCAAGTCAAGGGA
AGACAGTTGTACATCATAAACAATGCGAAATGTGTCATTT
CATTTATTCCCCCCGTAGGCCACTGGATTTATCAAGTCAC
CCAAGATCTAATTCCCTATACTCAAACAAAGCAAGATACC
AACCTCAAGCGTGCTACGCTAATTTACTTAGCTACAACGT
GCGTTTTTTTCTTCTTCTCTGGATTGGGATTTGTTTTAAT
TGTCGCTGATAATTGTTCGAGTCTATGTGCCAAATACCTC
CTCACGATTTTGCTCCACCTTGAGACGTCCGTCGCTCGAC
AAATACGGGTTTCTACAGGGTAACCACTGCTGTGGAGTCC
CCTTGATGAACAAGCTTTGCTGTCCAATGATCTTCATTCA
GAACAACACCATAAAAGCTGTCACGTTTTGCCACTTTTTT
TGCATGTCGTATTTTGTCAGTGTAATTTGTATTTGACGTT
TTAAAGCAATATGCTATGAGAACTTTTTTGGGACAAAAAT
TTATTTTTTCTAACACAAGGTACTTAAACAGCTCCGAATC
TGTGGTATTTTTAGACGTGTAGAGGTGGAAGATCCATTTT
CCCTCTGTCTTTATTGTAAATTCTTTATTATTTTCGTTAA
TTGTGGTCCCCTCTTTGTAAGAAGCAATATACATCCGTAC
GTGGATGCGAAAGCATATACAAGCGGAAGTCTGTGTGTTT
TGTGATATTTGTAATGTCTGCTTAAGGTTAAACCCCCCAG
ACAAGGCTTTAAACGATCAGGCGCAGCAGGGTGAGATGGT
GAACTGTATGTTAGATCTTACGTTACTTTCCCAGGATTTA
AAATATTTTACGTAGCACTGAGCTTAAATCCGTTGACAAG
GCTGTACTAGCATGACACACCGCACTTCGACGTTAACATT
TCAATTAGATTTATGCAACAAGGCCTATGCACTCACGGAC
TTCGGCACAATTACCGTTTTTTTCTTCTTCTCGCAATTCT
GATAAATGTGTCATGCTTGCTACAGCATTCGAGCTGAAGG
TTACTAAGATTTACGTCACTCATTTTCCTTGCGTTTTTTT
TCTTTCCTAAAGCACAGCTGACGCGCGTTATTAAAAGTGA
ACTATGTTTAGATAATAGACGAAAAGAAAAGTCTTTTAGC
CATAAACGAATGTCAAGCAATAATATATATGGTGTATTAT
GATTCATTTTGTGCATAGGCTTTGAACATCTGCATGTAAA
TACATTTTCTTATTTATCGCGTTTAATTTCTTTTTCCGCT
TTGCATTTTTCAGTTCGTTTTAGTTTTGTTTGTATATTGA
CTAGTTCTGTTCCCGGGTGGAGAACTACGAACGTCAAAAA
CGGCCTGTACAGCTACGTTTCCCTGTCCTCCTTTCGGCTT
TTAATTCACGATATTTAATGTTCTATCGATCACATGTATA
AAAGTAACTTTGTAACTTCTGTCTGTATAGGTAAGAAGAG
AATACTGCTATTAAGACCTGCTCAGTGCGAAATATTTATC
TGTTTTATCAGACACATCATGCTGTACAATATCTGTTTTG
AGTATACTTCTCTCTTTTAGACTTAGTTCGATTAGCGGTA
GGGTGTGCGGACATTAATTTTTGTGTTATACTGACGTGTG
GTGCTAGGTAAGTTACTTTTGTGAACAAAAATTATGGATT
CATAGACTAGGCCACCCTCTTAGTCCATTCATTTCACTGA
GTATTGATGCATTATTAATATTAGGACTCGATAAAGAATA
ATAATAATAATAATAACGATTATAATAACTATAATGATAA
AGATTACGATAGTAGTAAATTTACTTTCGAATACCCAGCG
AGTACCTGTATCAGTGTGCTAGTCTTGGGACACGGCTTGT
TTCCTTCCCACTTTTAAGATTATTAGCAAGTATCGGCTAA
GTTAAACGTTGCAGTTTTAAATTTTTGACAATTGTGCTTA
CAAAATGGATAATTTAAAAAAAAGCAGCAGTATTGTGTTC
GTTTTTGGGAGGCGTTTCTTATCCAGTGCTTATTTTTTGT
ATTGGACGCTGGAAGGACTTTAAACACGCGATTAACTAAC
GGATTGTCTGCCACTTTTTGGCTCCCTCCATATATATTTT
TTTTCATACATTCAGTTTTGTTTTGTTTTTCATTTTCAAA
GTCACACTTACACACACTCACATGGTTAAGTGTTAAAAAC
TGTACAGGACAAAAGCGGTTGTGCGAAGTTTTGTTGCGAA
ACTTCCTGTTTTTATCTTTGTAGCAAGGCAGAATCTACTT
GCAATAATTCTTAGCAAACGACGCTGAGTGCCTCTCAGTG
GTGCAGGATGCAGAAAATATATTCGTGCGTTATTGTTTTC
ACCGTTTTTTCGACCGTGTTTGCACTCGTAAGTGAATTCT
GTCTGATGTTCCCGACTTTTATTTTTCGTATGTAAATGAG
GCATTTCATGTTTGTTTATAGCCATGGAAACAACATTTAT
GGTCTCTGTGATGTCCTGACATTCTCTTTCCGTTTCCCTC
CGAACAACTTCACATGGGACATTTCATCCAGTCGGTTGGG
TGTATTTTGGATATTCGCAGAGACAAAATGGCGGACAATA
GACAATCCACTCCGTGTTCTCCTTGTTGTTTCCTGCCGAT
TAGATTTTAAGTTGACGATTATGGAACAAAATGACTAATG
CAATGTATTTTAAGTGTTCATATGTGTATGATGCATACTA
CACTTCTATTTCTCGTTGAGCTGAAGGGAAGGGCACAAGG
GCTGGAGCGGGACGGGTTGCATTTTGCTCCTGCCAACATG
CGGGGGGCGGGGGGAGGGGATAAAAAGCAGAAAACAGGTT
TGCGGTTTGTCACATATTTTTACGTCACATGTTTGCTACT
GATCTTAAAATGGGGACAGTCGATCATGTACCTTTTTATT
CAGCTCTTTGGAACTCTCTTTAGGAGATAGTCTCTTCTCA
ATAGTGGTTTTGCTCCTTCCGTTTGTCTGATTCTTAAATA
TGGAAATAAGTATTTTGATTCATTTTGTAAATACCGCTGT
AAAGAAAAATAAGAAATTTAATGTTGTCTTTTAAATACTT
TTCATTCTAATATGAATGTTGTTATATTGTACTTAGAAAC
TGTACCTTTAATATTACCTTTATTAAAAGTGCATTGGACA
CATCGATTTTAGATGTGCTTTATGTGCTGTTATCCCATAA
TAAAATTTACCGCTTGTAATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations