Transcript

cyr61-201

ID
ZDB-TSCRIPT-110325-264
Name
cyr61-201
Previous Names
  • cyr61-001
  • ottdart00000048464
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048464 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048464|OTTDARG00000034272|ZDB-GENE-040426-3 cyr61|OTTDARP00000038017 cyr61-001 LG_ CU672235.14 Danio rerio protein_coding KNOWN, 2567 bp
CCGTGCGCGCCTCCGGAGCAGAGCAGCGCCTTCATACGCG
CGGGAAAACAAACGGACGCTCCTCAGACTAAAGCAGGACT
TAAAAACGACGGAATTTTGCTCAAAATCAGCGAGCTGACA
AACACAGACGCGAAGATGTTTGCTTGGGCTGTTATCGTCA
TCTTTATTGCACACTTTAATATGGTATCCTCCAGCTGCCC
GGCGGTGTGCTCCTGTGCTCCGGATGCCCCCCAGTGTCCT
CCAGGAGTGGGTCTGCAGCGGGACGCCTGCGGCTGTTGTC
TGGTGTGTGCCAGACAGCTGAACGAGGACTGCAGCCGCTC
AGAGCCCTGCGACCACAGCAAGGGCCTGGAGTGCAACTAT
GGGGCCAGCCACGGGGCCACCAGGGGCATCTGCAGAGCTA
AATCAGAGGGCCGGCCGTGCGAGTACAGCAGCCGGATCTA
CCAGAACGGGGAGAGTTTCCAGCCCAACTGTAAGCACCAG
TGCACCTGTATGGACGGGGCGGTGGGCTGTGTGCCGCTGT
GCCCGCAGGAGCTCTCGCTGCCCGCGCTGGGCTGTGCCAA
CCCTAGGCTGGTCAAAGTGCCCGGCCGCTGCTGCGAGGAG
TGGGTCTGCGATGATGAGCAGCAGGGCGGGAAACTCATCG
AATCGGCCAATAAGATGCCTGGAAATAAAGAAGTGGGCGG
AGACTCGGAGAAAGAACTGACCAATAAAAACGAGCTGATC
TCTGTCATCATGAACACCAAACTCAAATCGTTACCTGCTT
TCCGATCGCATCAGATGGAGAAGTGCATCGTGCAGACCAC
CGGCTGGTCCCAGTGCTCCAGGAGCTGTGGTACAGGAATC
TCCACCCGAATCACCAATAATAACGCTGAATGCAAACTGA
TGAAGGAGAGCCGCATCTGTGAGGTCCGGCCCTGCAGCCA
GTCTCCACACACCAGCCTGAAGAAAGGAAAGAAATGCAAC
CGCACCAAGAAGTCTGTGACGCCGGTGAAGTTCTCTTACG
CCGGCTGCTCCAGCTTGAAGAAGTACCGTCCTCGGTTCTG
CGGCTCCTGCGTGGACGGACGCTGCTGCAGCCCCCAGAAC
ACCAGGACCATCCGGGTCAAGTTCCGCTGCCAGGACGGAG
AGACCTTCAACAAGAACGTGATGATGATCGAGTCCTGCAA
GTGCACGAAGCACTGCCCGCACGCCAGCGAGGCCGGATTC
CCCTTCTACAGACTCTACAACGACATCCACAAGTTCACAG
ACTGAGGAAACACTGACAGAAACACTGCTCTGACAGTCTC
TCACATCCAGAACTTCCGTCATCAAGAAGCATTTCATAGA
TGAGGATGAACTATTGTGCAGTTTTCAGAAATAATGAGTC
GAAATAAGCTGAAAACAAGCTAAATAATCACACCACACAC
GATTGTTTAGCTTGTTTAAATGAAAACTTCACTCAGTATC
TGAAAACAACACGATACTTTGCACTTCTTGATCTTCTTAA
TTTTCAGATGTTTGGAGACTAAGGCCGTGTCCACATGTAC
ATGGGTATTGTTCTATATTTTAAACAATTGCATGTGTGTT
AAGGCCATGCTGAACCTACAGGGGGCGACTTTACACCAAA
TGCGCATCAGTCATCTGAACATGTCACTTTCAGTTGTGTG
TTCGTGTTGATGAACTGAGGAACCGTGTAGAAGAGTACAG
TTTTGAAGATACCCGTGTTCGTGTGGACGATGCCTCCGTA
AGACGAGCTTCTTTCATGCACCGACCAATAGGCAACCGGG
GGTTCCGTCCGCCGGCCAATCAACTACCATCTCCTGTTGT
AACTAGATTCCCACGGAATTACAGACTTACGATACGGGGA
CTTTTATCGTGCACTGTTTGCTGAGGTCAGCGTTTCCAGA
AAAAACAAACGAACAATGTCTCGCTTCACAATGGAGCGCA
ATGTGTTAATGGCTTCGTTACGGAGCAACCTGTAAAGATG
CGCTTGTTAATATTTCAGTTCCTGATGTATATCTCGATGA
CCCAACTGTAGATTTGTGTATATGTGTGTGTGTGTGTGTG
TGTGTTCCAGTTTGCACATGCAAAACCTACAAGACTCAAA
CCTGACTCAAAGGTTGAGCCTGTCCAGTGATAACACACTC
CCTCCTAATGCGGGTGAACGCATCCTCATTAGCTGCGTCC
CAAATCGCATGCGTACGCACTGATCTGCGGCATTTATGAG
TATGAATAGTGCATTTTAATACTTGAATGATGCACTTATT
CAACTGTTAAACACAAGTACTACATGACTGCGTGTATGAG
AAGCGTGAAAAGCAGCATGTAAATGTAATTAATCATTAAT
TATAAGTGCCGGCTGTGTAATTTGTGACGCAGCTAATGTT
TGGCAGCTAGAGGAAACCAACATCAGATTAACAGCGGACT
CTCACACCGGTTGAGTGAATGTTTTATAATTGTTATTAAT
ATTATTTATCGCAAATGTAGCTCTTCTATTTGAACATTGT
CATACTGGAATAAAGTGTACAGGAAGAATTATCTATGATC
TAATTTTATATGTTATGAGTAAATAAAAGGTTTATTTATG
AAGCGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations