Transcript

anxa5a-201

ID
ZDB-TSCRIPT-110325-2346
Name
anxa5a-201
Previous Names
  • anxa5a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049490 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049490|OTTDARG00000034862|ZDB-GENE-080220-29 anxa5a|OTTDARP00000038821 anxa5a-001 LG_ BX004823.23 Danio rerio protein_coding KNOWN, 1202 bp
CTCGATTACAGGTGACAGAAAACATCAACAGAAGTTCACA
CAGTGCTGCCTGCATCTGTACACATGGCAAGTCGAGGCAG
TGTGAAACCCTTTGTGCACTTCAATGCAAAGCATGATGCC
GAAGTTCTGCGCAAGGCCATGAAAGGCATCGGCACTGATG
AAGACACTATCCTCATGTTACTGGCAGCTCGGTCTAATGA
CCAGAGACAGGAAATAAAAGCAGCTTATAAAAAAGCTTTC
GGAAAGGATTTGGTAAAAGACCTCCGATCTGAGCTTGGAG
GGAAGCTGGAGGATCTGATTGTGGCCCTCATGGCTCCACC
AACAATATATGATGCAAATGAACTCCATAAGGCTATCAAG
GGAGTGGGTACAGAGGATCAAGTATTAATCGAGATCCTTG
CGTCCAGGACATGTGAAGAGATTAAAGAGATTGTCAAAGC
TTATAAGAAAGAACATGGAGGAAAACTGGAGAAAGATATC
ATGGGTGACACGTCAGGACACTACCAGAAGATGCTGGTGA
TACTCGTACAGGCGGGCCGAGAGGAGGGAGTGGACGAGAG
CCGAGTGGAGAAAGATGCAAAGGAGCTGTTTGCTGCCGGA
GAGGAGAAATTCGGCACGGACGAGGACAAGTTCATTAATA
TACTGGGCAACAGGAGCGCCGAGCACCTGAGGAAAGTGTT
TGAAGCCTACAAAAAGATTGCCGGCTGTGACATCGAGGAG
AGCTTAAAAGAAGAGTGCACTGGAAACCTGGAAGCCCTGC
TGCTGGCTGTGGTGAAGTGTGCCAAAAGTGTGCCGGCTTA
TTTCGCTGAATGCCTTCGAGAGTCCATGCGGCGTGCCGGC
ACTGACGACGAGACTCTCATACGCATCATGGTGTCCAGGA
GTGAAAGGGACATGCTGGACATCAGAGCTGCTTACAAGAA
GAAATATGGAGATTCACTCTACGGCACCATACAGGAAGAC
ACTGATGGAGATTACCAGAAGGCTCTGCTCTACCTGTGTG
GGGGAAATGATTAGACATCAGCTAATCTCACACACTAGTT
TAATTCCTTTACAACTCATGTGTGTTTATTTGTATCTTTC
ATGATTTGAGCTGAATTAATCTAGTGTTCACTCTTTGATG
CTGGTGGTGTGATGTTTGCTGAATTGTTTTGAAGGTTTCA
AAGTTGTGTGAAGACTTAGAAAATAAAGGCTTGTGGATCT
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations