Transcript

sdc4-201

ID
ZDB-TSCRIPT-110325-2189
Name
sdc4-201
Previous Names
  • sdc4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048989 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048989|OTTDARG00000034600|ZDB-GENE-061111-1 sdc4|OTTDARP00000038443 sdc4-001 LG_none CU463256.4,AL954861.11 Danio rerio protein_coding KNOWN, 2306 bp
AGGAATACTGCGTATTAACACAGAGGACAGCAGCAAGAAG
TTCGCGTTAAAACGTCTCAACAAATCGAACACAAAAGGAT
TAAAGAAACCAGGAGCGGTTTATTTCTATATACGTTACAG
AAGTTATTCTTTACGAAACGGACAACTTTATTCACTCGGG
CTACTTGTATTGAAGAGAAGATGTTGAAAGTTTACCTCAT
GTTGGTTTTGTCGGCGGCTGCTGCTGTTTTCGCTGAATCG
GTACGAGAAACTGAAACTTGGGTACCTCTGAAAAACAAGG
CGGCCATCGAGGACCTGGAGTCCTCCGGCAACTCACAGAA
TGAAGACTTTGAGTTCACCGACTTAAACCAGACTGACGAT
GAGGATGGCTTTGATGAAGATGATGAAGACGATTACGATG
ACATGTCAGGCTCTGGGTTTGCAGATGTGATCGATGATAT
TGAGGATGAATTTGTGAATAACCAGATCCCTGATGATAAG
GGTCCATTTGCTCCAAGGCCAACTGTCGATGAGAATATTC
TGGTTCAAAACAATGAAGTTTTCTTGCGTGGAGCACCAAA
CCAAGACTTGGACAATCACAGCAATGTGCTCATGACTCAC
GCTGGAGATGATAGCTTGTTCAACAACACAGAAGTGCTTG
CAGCTGTTATTGCGGGCGGAGCAGTTGGCCTGGTTTTCGC
CATCCTCCTCATCATCCTCCTCGTTCACTTCGTTCTCCGC
ATCAAGAAGAAAGACGAAGGAAGTTACGACCTGGGAAAGA
CGCCCATCTACAAAAAAGCTCCAACCACAGAAATCTACGC
ATGAGCATCCGCACCCTTGCATACCTTCTCTCTATCTTCG
AACTATAAGCTCACACAGTGCCTCGGCTGGACTGCCGCCG
CCAACCTCTCACGTACCACCAAAACCGCAGGAGGACCTCA
CACCAAAACTTCACTCTGACTGGACATTTACATCCAAACA
TTAAAGTGACTCGGAGGGATAAGCGTCTGTTGCCAAACCG
CTCCATTCAGAAGATGTTGGTGTCTTCATGCTCTCACACC
CTTCAAGTTTATTGCCTTTAATCACGTGGCTCGTTGTGTC
CAATTTTTTTTTCTTTTTTTTTTCACAAAACACTAAATGG
TGCAATGGAGCCTTCACAGATTAAAGGCTGTGGATTTACC
GTTTCAACCACCCGTTAAATGAACAGTCCGTGTCACGATT
GGTGCTACAGTGGAGGTGGTTACTGTAGCCTTTCACGTTA
TCAACAGATGTCTTTGTTTTAAAATCTGTGTGCTGTAAAA
CATTATTTTAATTTGCATATTAAAAACATCAGAGGTGAAA
CCAAATTGAGGGCATGCAGTATGTGTACGCAACTAAATTG
AGAACCTGAAGTCATTGTACTAGATTTTAACGTACGCTCA
TTTCAAGCATGGTGTTATGGTACATTCCGCATGTCTGTAT
GTCATTGCTGTGGTGGTTTTATATGGGAGAATAGATCCAC
TACGGTCACCTAAGCTACTTTAACAGGTACAGATGTTGTT
GATTTGAGAATCAGTTCACTGCAAACAGACTTTGTGCATC
CAGGGATCTGTATATAGCCATTGAATAAAATGTAAAACTT
TGGTACTTAGCCATTTCTTGACAGCCTTTTATTTACCAAA
TATTTAAATGCCAAAATCAGTTTTTACTGTTCCTATATCT
CATCCCGGTATTCGCTTTTGCTGTAAAAGCTGTACGTGAA
ACGCAGATGCTTTGCATCTTTATCTTTTGGAAACATTATG
GAAATGTTTTGTTGGAGAACGATGACCAATGCTAGTACTA
ACTATTTTTTTTCTCAGTGTTTTTGTAGATGTCCTTAATT
CTTTTTTTTTTTGGTATTAATTTAACTGTCATATTTTATT
GCCTGCCTTCAGGTCGGGGGGTCTTTCTCCCCCATCTCAG
CTGTTGTATATGTGATAATTATTTTATTTTATTTTTTTTG
TTTTATTTTTTAGATTTGTTTTATATACAGTAGTGCAAAA
AAATGCAAAGGCTGTTAGTCTTTCGACAGATTTGTTTTTA
AGAGTTTCTATTTCGTTTAGACTTTTTAAGCTGAATCTAT
TTATGTTTTGTAGAAGGATGTTCTGGATTAGTTAAGGGGA
TCGTGAATGAGCTGTGCATTAGCATGGCATAAATGAGAGA
GAAATTCTGCTGCTTTGTTTGGTCACATCCAGATTAAAAA
GAAAAAAAAATCACTGATCCAATGTTGAAGTCAATGAATC
ATTGATTTCTGCATGGAGGTTTGATCTGTTGAAAATAAAG
CTATTTTATGCACATAACCATTGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations