Transcript

tfap2c-202

ID
ZDB-TSCRIPT-110325-2151
Name
tfap2c-202
Previous Names
  • tfap2c-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048866 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048866|OTTDARG00000034527|ZDB-GENE-041212-61 tfap2c|OTTDARP00000038351 tfap2c-001 LG_none CU469361.12,CU468952.13 Danio rerio protein_coding KNOWN, 5033 bp
TCAGCGAGTCGAGACTGTCCGTCAGAGGGAGTCACTGCTT
CTGTCCCGCGTTTCACTTTGGATCGAGTTAGTTGTTCGTG
CAATTAGTTTCGAGTCTCGATGTGCGTCAGTTTCTCTTCA
GTTTTCCTCCTCCTTCAACACTGAGTTGATGCTTCACTTG
TGCGCAGCGCGCGCCGGACTCTCTGGATTATTTTCTAGAC
CGCAAACTAACTCTTGCACAGATACACACTTCTGAGATCC
AGCCTCACAGAAACAACATGTTGTGGAAATTAGCAGATAA
CGTCAAGTATGAAGATGACTGCGAGCAGGAAAGACATGAT
GTTAGCAGCAATGGGAACCCTCGGTTACCTCACATCCCTG
CGGTGAGCCAGCACCTCTACAGCCCACCACCATCCCTTTC
CCACCCCGCTAGCTCGGACTTCCAGCCTCCGTATTTCCCT
CCACCTTACCAGCCTATACCATACACCCAACCCAGCGACC
CATACTCTCATCTGGGCGACCCGTTTAACATCAACCCCAT
ACACCAGTCTGCAAACTCCAATCAGCAGCAGTCATGGCCC
GGACGGCAAGGTCAGGAGGGCATCGGAGGTCATGGTCGAA
GCGGACTCGGAAGTCCTATTCTGGGCCTGGAGGGGGGCTC
GTCCGGGATGCGGCGGGATGGTTTTAGGAGGCCAGAACTG
CTGCCTCCGCATATCCATGGAATCGACTCTTTAGGCGACA
ACATTGGTTTGCATGATATAGGTCACGGGATGGAAGATGT
TCAGCACGATGGTGATCACAGTATTATAATCCCAGATCAT
ACGGTCATCAAAAAAGGTCCGGTGTCTCTGCCCAAGGGAA
ATGCATTTGGGATTCCCTTTCAGAAAGAGTCCCTGCTGGG
AATGGTGTCGAATCCCACTGAGGTCTTCTGTTCGGTTCCT
GGCCGTCTCTCTCTTCTCAGCTCCACTTCCAAGTATAAAG
TAACTGTGGCAGAAGTTCAGAGACGCCTGTCGCCGCCCGA
GTGTCTGAACGCATCCCTGCTTGGAGGAGTATTGCGCAGG
GCAAAATCAAAGAACGGTGGTCGATCCTTGAGGGAGAAGC
TGGATAAAATTGGGTTGAACTTGCCGGCGGGTCGCAGAAA
GGCTGCTAACGTCACATTACTGACTGCATTGGTAGAAGGT
GAGGCCGTACACCTGGCCAGGGATTTTGGGTATGTCTGTG
AAACGGAGTTTCCCGCGAAGGCCATTGCTGAATATCTTGG
CCGACCACATGTGGAACGCAATGAGATCAACTCTCGCAAA
ACCATGCTGTTGGCAGCCAAGCAAATCTGCAAGGAGTTCA
CCGACTTGCTGACTCAGGACCGATCTCCTCTGGGAAACTC
TAGGCCGGCTCCCATTCTGGAGCCCGGGATTCAAAGCTGC
CTGACTCACTTCAGCCTCATCACCCATGGATTTGGTTCTC
CGGCTATCTGTGCGGCCATGACCTCGCTGCAAAACTACCT
CAACGAGGCGCTCAAACAGGTGGACAAAATGTACGTGAGT
TCGACCGGAGACTCCTCACAAGCCTCTTCCGATGGTACCA
ATAAAGCAGACAAGATGGACAAACACCGAAAGTGAGACTT
GATGGAATTTGGATTGGGACCATTCGAGCGCAATAACCGT
TTTTGTAGCAGAACTACGTTTTTACCAGATCTGTCGTCGT
TGTTGTAGTAGTTGTCGAATTTGTTTCCGTTCTGCTTTAT
TTGTTCCGACGTCAAGGTTTAACGTCGAGTCTTGGTCTTC
CAGCACTTTCTCCTCCACAAAGACACACATTTCAATGGTT
AGCCTTAGAGTTGTTTATCGGCCAATCCCGACTCAGATGC
TCATCAGGAAGTTGTCTCTCCGAGGGGGGAACTGCAAAAA
ACGAGGAAGTTGTCGAGTTTCCCCAAAGACACCATTTCAA
GAGCTGACGTGGATTTTAACAATGTTTTTCTTTCACTACC
GATCTGGGAGGAGGAAGCTGGGTTTCTCTGTGTCCTCCTC
CTTGGTGCTGACCTCCTAATGGACTTATCAAGGATGTGAT
TATATGTTTTTGAGACATTATACGCTTCATTGGACACAGT
GTTATTGTTCTTCTGTTTGTGGGTGTGTTGTCGGCATGAG
TGGTTGTTTGTATGTGTGTGTGCATGTATTTACATGATTA
CTAAGCCCTATATTCACAACATCAGTGGATTTTTACTATT
TGTCACCCTGGATCCCAAAACCTTTAGTCTTGAGTTGCAC
AGGTTTCTTTTTGTTGATGGCAAAAATGCATCGTGTAGGT
CAACATTTTATTTAGTGCCAAAATCTTTAAGATATTAAGT
GAACATTACTTAATCTTCCATGTTTCACAAAGACATTTTG
TAGGTTTATTTCTATAAATCTATCAAAACCTAATTTTTGT
TTAGTAATGTGCATTGCTGATAACTTCATTTGGACAACTT
TAAAGGTGATTTTTCTGAATATTTAGATTTTTTTAACCCT
CATTTCTCTCGACCAAATATTGTCCCAGGAAAAAAAACTA
TACACCAACGGAAAGCTCATTTATTTGGTTTTCAGATGAT
GGATACATCTCAATTTTCTAAGCTCTAAATTTACAATATC
AGTGGAATTTTACCATTTGTGACTCTGGATTTTTCAGAAA
CCAGTCTTAAAGGGCCATGACACCCCCCACTTTCGGTTAA
AGTCTACTTCAGAATTTTTTCAAAAGATGCATGATTAATG
GGCGTGGAGCTCCGCGAGCATCGGGCAGGAGTGGGCGTGG
CCAGCAGGGGAGAAGGGGAGCGAACAAAGCTAGCTCACAA
AATGAGACAAACCGTGAGGAGACGCATGAGTTTATAGTTT
ACAAAGTTAAAATGCAAAGAAATGAACAGTGATTTAATGC
CCTGCTACATTTGTTTTTCGTAATTTCATATACAGATAAC
CACAGTTTATATCATTATAAAGATAAGTGTGTTCATGTAA
ACACTATAAATGAGGACTTCTCCCTCAATCCCCGTATCCA
GCAGACTCAGTGCAGCAGGTCTCCTGACCCGTCTATTTTA
ACCGTTAGCCCTGCTGGTAATCTGGAGGATTTAGGCAAGC
ACAGCAGCACGGCGATGTGTCTGAATGTGAATGAACCCCT
GATAAAAGACAGCGTCCGCCATTCTCTAATTCTCGTGCTG
CTCTCCCGACAAAAATGCTTGCAGCACACAAACAGCTTTG
CTGTATGATCGGCCCTGACAAGATCGCGGGGGAAAACATG
CAACAAACCCCGTGGATCATGGAAACAAACGCATATGAGC
CTTCATGAATGGCTAAAAACTGTGTGCTTGGGTCCGTGTC
TCACAGCTCGGGCTCGACTCTGGCAGGTCTGGCAGGTCTC
ATGAATAATTAAGCAGCCGGCTCTTCTTATAGGATAAGAA
AACTCGGCTATGAATAATAATGAGAAACCGCTACGTCGCC
GATTTTGATCCCGCCCCAAAAATCATTTTAAACCCGGAAG
CTGAAATTAGCTGACAAAAGCTCAAAATTATTCAGTTTTC
CCCACAATTAAAGCTGACTGCTGCTAACATTGTCTTAACT
GATGCTCAACACACAAAATTTGTTAATATAAAAAAAAGTT
CTCCAGTGTGTCCTGAACCTTTAAGTTGCACAGGTTTCTT
TTTGTGAATCGGAGAAATGCATCGTGTAGGTCAACATTTT
ATCTTGTGCCAAAATCTTTAGGATATTAAGTGAACATCAC
TTAATCTTCTATGTTTCACGAAGACCTTTTGTAGGTTTAT
TTCTATAAATCTATCAAACCCTAATATTTCTTTAGTAATT
TGCATTGCGGATAACTTGATTTGGGCAACTTTAAAAGTGA
TTTTGTTCAATATTTAGATGTTTTTTAACCCTCACATTAC
ACATTGTATCTCTGCAAAATATTTTCCCATTTTTACAAAC
CATACATCAAAGAAAAGCGTATTTATTCGGTTTTCAGATG
ACAAATACATCTAAATTTTCTAAGACCTATATTCCTGATA
TCAGTGGATTTTTACCATTTGTTTATCTGGATTTTTTACA
AAGCCAGTCTTGAGTTGCACAGCTTTCTTTTTGTAAATCG
AAGAAATGCAATGTATAGGTCAGCAATATTTAGTGCCAAA
ATCTTTAAGAACATAAGTGAACATTACTCAGTCTTAAATG
TTTCACAAAGACATTTTGTAGGTTTATTTCTATAAATCTA
TCAAAACCTAATCTTCACTTAGAAATGTGCATTGCTGATA
ACTTCATTTGGACAACTTTAATGGGGATTTTCTGAATATA
ATTTTTTTTTAACCCTCACATTGGAGATTTACAAACAGTT
GTGTCTCGACCAAATATTGTCCTATCATAACAAACCATAC
ATCAACCGAAAGCTTATTAAGTTTTCAGATGACGTATACG
TCTCAATTTCCTCAAATGTACACTTATGACTAGTTTTGTG
GTATTTTTGGGGTCACAAATGAGACATCTTCCATCTCAAT
CAGCTAGGAACAATTTAAAAGACCCTGATGATTAAGTTAA
CATGATCAAATATCATACGCTTATTAGGTGTGTGTGTGTG
CGTGTGTGTGTGTGCGCGTGTGTGTGTATGAGTCTGTTCA
TCTGTTCGTTGCCTTCACATACAGAAGTTAAATGTTCCAT
TTGTCTTTCCCCAAATGTAAATAATTTCTAATTTATGTTG
TAATTTAATGGGATTTGTAAATATTGGTACAATTATGGTG
TTTGGTTCCCACTTTTTAAGAAAAAAAAAAGATGTGTTAA
GCTTTTATAAAGGGTTCTTTTTTGTTTTGTTTTCAATAAT
ATAGTGGTTAGGCTATGGGATCGATATGCTTTGATATGTG
TAATATTGGTTTTAAAGCTGTAGGAATAAAAACTCAACAC
TCTTGAATTGTGTTGACCGAGACTGTCCATTTTTACGATT
TGTAGAGTTGTACACTTCACTACACGCATGCCCTGCCAGT
GAGGCGTGTCGAAAAATGGCCAATTCATGTGTATAAAGAT
TCCTTTTTAAAATAAATGTCAGCAATGCTCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations