Transcript

si:dkey-88e18.2-202

ID
ZDB-TSCRIPT-110325-1853
Name
si:dkey-88e18.2-202
Previous Names
  • dkey-88e18.2-001
  • si:dkey-88e18.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039522 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039522|OTTDARG00000028876|ZDB-GENE-110411-159 si:dkey-88e18.2|OTTDARP00000031614 DKEY-88E18.2-001 LG_ CU467655.8 Danio rerio protein_coding NOVEL, 891 bp
ATGTGTCAGCTGACAAGAGTCATCCTTCTCCTCTGTTTGT
CCATAGTGAGACTGTCTGCGCTTAACTTTTTCCCAGGGAA
ATTTGGCGAGAGAGGCACAGACGTGATCTTGACCTGTCAC
ACAAGTGAACATGAAATCACGTGGAAGCATCAGGACGCAC
ACAGTATATCGAAAATCTCAGGATCAGAGTTTGAAAAAAT
CAGCGGTCGAACTCTGACCCTGATGGACCTGGACGAGGAC
CAGATCGGCAACTACACCTGCTGGAGCCAACAGGGTCTGG
AGGACTACACCTATCTCCTGCTGGATAAGACCAAAGAAAC
TACAGCTTTCAACCTCAAATGCACAGCCGAAAGTTTCTCC
TGCACTGAACGAATCAAATGTTCCTGGAGATCGGATGCAT
TTACTGCGTTCAGACTACGCAATTCAAGGGATAATGGAAA
ATGGGTGTCAGAGTCTGTGGACGGGGTATTTTATCTCCCA
CATTCAACCGATTCCTATTCTGAGGAGTCTGAGCGACTGC
AAATAACAGGAGAAGCTCTTTCTGCGTGCTGCTATATGAA
AACTGACTACAGCTTCTTCCTGAGAGACATCGTTAAGCCA
GCCAATCCAAACATTTCCATCTGCAGAGTAAAGGATGAGG
GCAGTGATGAGCAGATAACCGAGGTGGAGGTGAAGCCTCC
ATCCTCTTGGCCACAGCCGCAGAGTTTCTTTCCTCTGACG
CACCAGATTCAGTATGAGAATCGAGATGATGGCATGCTGA
AAACTAAAGAATGGGAGAAAGACTCAAAGGTCACAGTTAA
GGGCTTGATCAGAAAGCTGCGTGCCCGCTGCAGAGACCCA
CTGCTCGTCTCCCAGTGGAGTGAATGGACCCCCTGGACAA
ATGTAAACTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations