Transcript

reep1-202

ID
ZDB-TSCRIPT-110325-1493
Name
reep1-202
Previous Names
  • reep1-001
  • dkey-21a6.4-001
  • si:dkey-21a6.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049707 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049707|OTTDARG00000034987|ZDB-GENE-110411-267 reep1|OTTDARP00000038993 DKEY-21A6.4-001 LG_ CR405694.8 Danio rerio protein_coding NOVEL, 1427 bp
ATGGTCTCCTGGATTATTTCTAGGCTTGTGGTGCTGATAT
TTGGTACCCTTTACCCAGCATACTCCTCATACAAAGCTGT
TAAATCGAAAGATGTGAGAGAATATGTAAAATGGATGATG
TACTGGATAATATTTGCACTTTTTACAACAGTGGAGGTGA
TTACTGATATCTTTTTGTGCTGGCTCCCATTCTACTATGA
ACTCAAAATCGCCTTTGTGGTTTGGTTACTTTCCCCGTAC
ACAAAGGGATCCAGTGTGCTGTATAGAAAATTTGTCCACC
CCACACTGTCCTCCAAGGAGAAGGACATCGATGAATATCT
TTGCCAAGCAAAAGATAAAAGCTATGACACCCTCATGCAT
TTTGGAAGGAAAGGCCTGAATGTAGCAGCAACAGCTGCAG
TAATGGCTGCCACTAAGGGCCAGGGCGTTCTGTCCGAGCG
GCTCCGCAGTTTCAGCATGCAGGATCTGTCATCTTTCCAG
GCTGAGGGCCAGACAAACAGCGCTAGCTCTGTAACCACTC
AACCTGCAGCCGCGCAGCACAGAACGCGAACCATGATGCG
CAGCAAATCAGAGACTGGCTACAGCAAGGCCTCCTCCTAG
ACCTCTAAGACCTTTCACCCGATCCAGATCCAAGAACGCC
CTCTCTTCAGACACTGAAGCCATGTGACTGTGCGTATATG
CTCCCAGAGTGCTTTAGCCGTCTCACCTGCAACATGAGGA
GATGCAACAAGAGAAGGCAATGACAAAAAAAAAGAGGAAT
GCAGCCAAAATGTTCAAATATTCAAAAGCAGCCTTGCTCT
GTAATGAGGTAACCAAAGCGATGCGCAACCTTTCGCTTCT
GATCTTTGACACTCAAGGGGAGGGAATCCATTTTGGGTAA
CGCTGCTGCTCTGAGACTTTGGGGTTGTTTTGTACATATT
TGAGCGTAGGCTGGTATGATTTTGGGAGAAACAAGCGCAT
GCGTGTCCTTTTGGTTTCTGTGGTCACCCCCAACCATAAT
CACTATGGTTCAACATGCTTCATTTTTAGGGGGAGTGCAT
TCATCTTTGTTTGAGTAAATTCCTGTAAAAGGACAGATCA
CCCCCCCCCCCCCCCAACCTGAAAAAAAAAACAACTCACT
ATTTACTCCTATCTTTTATGAGTTTCTTATTTCTGTTAAA
CACAAAAGAAGATATTTTGAAGAATGTTGGAATTAGGATT
GAGGATCGAGAACCCGTTTCATTTTAGAATCATTTCAAAT
TTTTAAAAACCAGGGATTCAATATGATGCCTACATTTTGA
TTCTGTTTAGCAATTTTTTACTTTTTCGGTCATTCTTGCA
TAGTGAACGATAGTTTTATCTATCTACCAGGGCCTGCTTA
TGCACTAAGGGCTCTATTTTAATGATCTAAGCGCAAGGTG
CAAAGGCATTAAGGGCGTATCTGAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations