Transcript

gnrh2-201

ID
ZDB-TSCRIPT-110325-1440
Name
gnrh2-201
Previous Names
  • gnrh2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049495 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049495|OTTDARG00000034865|ZDB-GENE-030516-1 gnrh2|OTTDARP00000038825 gnrh2-001 LG_ CR847785.15 Danio rerio protein_coding KNOWN, 659 bp
AGAGAATGAGTGGCAGAAGTATCTCAGAGGCTCTGTGATT
TCACTCAACCGCTCACTTCAGGAAAAAGAGAACATTTCAG
GATTACCAACACCGGGACTACAGTAGAGGAGCTACAGCAA
AAGATACCTCAAGAGAAGACGTGCCAAAATATTAGACTGA
AGTGATGGTGCTGGTCTGCAGGCTGCTGTTGGTCATGGGG
CTGATGCTGTGTCTGAGTGCTCAGTTGAGCAGCGCTCAGC
ACTGGTCTCACGGCTGGTATCCTGGAGGAAAGAGAGAGAT
AGACCTCTACGACACCTCAGAGGTTTCAGAGGAAGTGAAG
CTCTGCGAGGCAGGAAAATGCAGTTACCTGAGACCGCAGG
GAAGAAACATCCTCAAGACAATACTGCTGGATGCCCTCAT
TCGTGATTTCCAAAAGAGAAAGTGACACCAAGCTGATGCT
TCAGCCTGTGTCCAAAGAAACATCTTTTCCAGCAAACACA
TTTGGCCTGCCTTTTCATTCCAAACTGTATATATTGTGTT
ATTCCTGTGACTTTATTTCTTTCATTTTGTATGTGTATGT
TTAGTTCTGTTCTCATATTCATTGTGAGTAAATCGACTGC
CGGCACCGTGTACCCATTTGCAGCAGTTCCTACAATAAAG
GCTTTATTTTGGTATTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations