ZFIN ID: ZDB-TSCRIPT-110325-1440
Transcript Name: gnrh2-201
Previous Name: gnrh2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049495 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049495|OTTDARG00000034865|ZDB-GENE-030516-1 gnrh2|OTTDARP00000038825 gnrh2-001 LG_ CR847785.15 Danio rerio protein_coding KNOWN, 659 bp
AGAGAATGAGTGGCAGAAGTATCTCAGAGGCTCTGTGATT
TCACTCAACCGCTCACTTCAGGAAAAAGAGAACATTTCAG
GATTACCAACACCGGGACTACAGTAGAGGAGCTACAGCAA
AAGATACCTCAAGAGAAGACGTGCCAAAATATTAGACTGA
AGTGATGGTGCTGGTCTGCAGGCTGCTGTTGGTCATGGGG
CTGATGCTGTGTCTGAGTGCTCAGTTGAGCAGCGCTCAGC
ACTGGTCTCACGGCTGGTATCCTGGAGGAAAGAGAGAGAT
AGACCTCTACGACACCTCAGAGGTTTCAGAGGAAGTGAAG
CTCTGCGAGGCAGGAAAATGCAGTTACCTGAGACCGCAGG
GAAGAAACATCCTCAAGACAATACTGCTGGATGCCCTCAT
TCGTGATTTCCAAAAGAGAAAGTGACACCAAGCTGATGCT
TCAGCCTGTGTCCAAAGAAACATCTTTTCCAGCAAACACA
TTTGGCCTGCCTTTTCATTCCAAACTGTATATATTGTGTT
ATTCCTGTGACTTTATTTCTTTCATTTTGTATGTGTATGT
TTAGTTCTGTTCTCATATTCATTGTGAGTAAATCGACTGC
CGGCACCGTGTACCCATTTGCAGCAGTTCCTACAATAAAG
GCTTTATTTTGGTATTTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gnrh2-201 Contained in:
[BAC] DKEYP-87D8 (1)

Genome Resources: Vega_Trans:OTTDART00000049495 (1),  Ensembl_Trans:ENSDART00000065779 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF511531 (1) 659 nt
GenBank:AY657018 (1) 653 nt
CITATIONS (2)