Transcript

slc39a7-202

ID
ZDB-TSCRIPT-110325-1370
Name
slc39a7-202
Previous Names
  • slc39a7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049268 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049268|OTTDARG00000034740|ZDB-GENE-991110-20 slc39a7|OTTDARP00000038663 slc39a7-001 LG_none FP074902.6,FP067442.4 Danio rerio protein_coding KNOWN, 1983 bp
AATCAAATGTGTTGACTGAATGCCACGTCGGTTTGAGTGT
GAGCAGCATCTTAACTGCTTTCACTCTTTACCAGAATAAG
CTAATTTATATTAGTTTTCGCAGCTTATACCGTTGCTAGA
CGTGGATGCGGTTAGCAGATTGCTAACTTATTCAGTGCAC
GGTACTGGCGCGTGCTTTGGTTTTTTCGGCATCACTAGCA
GGAACAATGAGGGTCTTTAGCAAATCGCTATTGCTGATTG
CTGTTGGCATTTTAATGTCCCAGCAGACACTGGCTCACTC
CCACCATCATCATGGACATGGTGATGGTGGATGCCATGGT
CACTCACATGGTGGAGCGAAGATGCATCACGGGGCAAGCA
AATGGAGTGCTGAAGCTAATCTGCCTCATGCTGAAGAGGA
GCATCACGTACACGATCACGGGCACACACATAATCATGCA
CACGATCACGGGCATGCACACAGTCATGGAGACATTCATG
ATCATGGACATGCACACAAGCATGGACACGCACACGATCA
TGGAGCTGAGAAATCGAAGAAAGTTGTGGAAGCAGGCAAA
CGGAACATGGTGGAGCTCTGGATGCAGGCCATTGGAGCCA
CCCTGCTCATTAGTGCTGCACCATTTCTGATACTCTTCCT
CATTCCAGTACAGTCAAACACTGACCAGCACCAGAACCTG
CTTAAAGTGCTCTTGAGTTTTGCATCTGGTGGTTTGCTTG
GAGATGCATTCCTTCATCTCATTCCTCATGCACTGGAACC
TCATTCTCATCACAGTCAGCCACACAGCGAGGAGTCCCAT
GGCCAGTCGCATGGTGAGGAGTCACATGGTCACTCTCATG
GAGCTGCCCATGGTCACATGATGTCAGTTGGTCTGTGGGT
GCTAGGTGGCATTGTTGCATTTCTAGTGGTTGAGAAATTT
GTTCGTCTTTTGAAGGGAGGACATTCACACTCGCATTCCC
ACTCTCCCTCTGCTCCAAAGTCAAAGGATAGTGATGAAGA
AGATGACAAGAAAGGACAAAAGAAGGGAGAGAAAGACAAA
GTTGTCTCTCAACAGAAACCTACAAAGAAAACAGTAGAGA
CAAGTTCTGATATTAAAGTGTCTGGTTATCTGAACCTGGC
TGCTGATTTCACTCACAATTTCACGGATGGTCTTGCAATT
GGAGCATCTTTCCTGGTTGGTCCAGCTGTTGGTGCTGTTA
CCACCATCACCATCCTCTTACATGAAGTACCACATGAAAT
TGGAGACTTTGCAATTCTTGTCCAATCAGGCTGCACCAAG
AGGAAGGCTATGTGTCTTCAGCTTCTCACTGCTGTTGGTG
CATTAGCTGGAACTGCCTGCTCCTTATTGGCTGAAGGAGT
GGGTGACGCGGCCACAGCGTGGATCCTCCCCTTTACTGCC
GGAGGCTTTGTTTACATTGCGACTGTCACAGTTCTCCCAG
AGCTGCTGGCTGGACACTCTAGTTTCTGGCAGTCACTCCT
GGAGATCCTGGCTCTTCTGTTTGGAGTGGGAATGATGGTG
CTGATTGCAGAGTATGAGTGAGCGAGGAAGCCATGTTTAA
AAGAAGAACTTGGAATATGAGGCGCAGTGACCAATGTATG
GTCACCGGAAGCGCAGAGAAACTTTGAAATGTATGTTAGC
ATTGACCACAGGAGGAAAACCTGCGTAAGAAATAAAAAAA
GTGCTTTTATGAGAAAACTACTCATTTATGCAAAGACCTG
CATGAATGGATCACATAAAACAACCTCACCAGGGACCAAA
ATTTAGATCTAATACATGCATACAAATCATAGGTATACAC
TAAAGAGACTGATAGAATCAGAATGTGCGGACCATTACGT
TCCAAAGTTACTATGTCTCCAGTCACTAAAACATGTTTTG
CTAATCAATTTATTTGCTTATCAAGAAATTGCAGTAATGT
TTTGATTTGAAAAATCATTTGACTGCACTTCACGCAATAA
AGAAGTATGTGATTCTTTCTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations