Transcript

gadd45ab-202

ID
ZDB-TSCRIPT-110325-1301
Name
gadd45ab-202
Previous Names
  • gadd45ab-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049053 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049053|OTTDARG00000034630|ZDB-GENE-040704-60 gadd45ab|OTTDARP00000038491 gadd45ab-003 LG_ CR391961.13 Danio rerio protein_coding KNOWN, 896 bp
GGAAGTCGGTGAATGCCATGTTAGGAAGGGAAACACTCCA
CATTATCAGTTGGAACAACAGAATGGACTCTGTTGAAAAG
GCACTGGAAGAGGTCCTGACAGCTGCATTACCTCAGGGTT
GCATCACTGTGGGAGTTTATGAAGCAGCGAAGTCGCTTAA
TGTGGACCCAGACAACGTGGTCTTGTGTCTGCTGGCCACA
GATGAGGAGGATGTAAAAGATGTGGCCCTCCAGATCCATT
TTACCCTGATTCAAGCCTTCTGTTGTGAGAACGACATCAA
TATCTTGCGAGTGAACAACATGAGACGTCTGGCAGAGATC
CTGGAGGGCATGAAACCGGGAGGAGAGTCGATGGACCTCC
ACTGTGTATTAGTCACCAATCCTCAGTCATCCACATGGAA
AGATCCAGCGCTCAGCAAACTGAATCGATTCTGTAGAGAC
AGTCGGGGTTTGGACCAGTGGGTGCCAGTCATCAATCTCC
CCGAACGATGAACAGAAGCAAACAATCTACTTCACAGCTT
TTACAAGCTACCGCACAAGATTGGAGTTCTGCTCTGGATG
AAGCCTAATAATAACGAGGGATTAACCAAACGCACTGGAT
GAAATGTATTCCAGCAAACACAATGATCAGAACAAGTGTG
GATTTTGTGTTTCCAGGTGATTCAGAACAGGAAAAATGAA
TAAATGACTCAGCGCTGTGTTCAAAGTGCTGCAGGGATTG
AGTTTACCGGGAAAGAGACTGGACAGGAAACTGAATCACA
CATGCTGGATTGGAGTTTTAAGACTGGAGCACGTGCAGCT
GGAATCTACTCGAGCAAATGTGATCTGGCTGTCTGAGATC
AGATGGGCTGGGAAATGTTGGGCTTTTTGCAGCCTCGCTG
CAAGAGCATAACTCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations