header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1272
Transcript Name: hsp70l-201
Previous Name: hsp70l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048952 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048952|OTTDARG00000034578|ZDB-GENE-050321-1 hsp70l|OTTDARP00000038412 hsp70l-001 LG_ FP017299.16 Danio rerio protein_coding KNOWN, 2302 bp
AAACTCAACCGAAGAGAAGCGACTTGACAAAGAAGAAAAG
AGCAGCCTGACAGGACTTTTCCCCGACGAGGTGTTTATTC
GCTCTATTTAAGAATCTACTGTAAGTTTCTTGAAATCAAT
CATGTCTTCTCCAAAAGAAATCGCTATTGGCATTGACCTG
GGCACCACCTACTCCTGTGTGGGGGTGTTTCAGCATGGAA
AAGTGGAGATCATCGCCAACGACCAGGGCAACAGAACAAC
ACCCAGCTATGTTGCCTTCACAGACACAGAGAGGCTGATT
GGAGACGCAGCTAAAAACCAGGTGGCCATGAATCCCAACA
ACACGGTGTTTGATGCCAAGAGGCTGATCGGCAGGAGGTT
TGATGACCCTGTAGTGCAGTCTGACATGAAGCACTGGTCC
TTCAAAGTCGTCAGTGATGGAGGAAAGCCAAAAGTTGCAG
TGGAACACAAAGGAGAAAACAAGACCTTTAATCCTGAAGA
GATTTCCTCCATGGTCCTGGTGAAGATGAAGGAGATTGCA
GAAGCTTATCTGGGGCAGAAGGTGACCAACGCAGTTATCA
CAGTTCCAGCCTATTTCAACGACTCCCAGAGACAGGCCAC
TAAAGATGCTGGAGTCATCGCTGGACTGAATGTGCTCCGC
ATCATCAACGAGCCCACGGCTGCAGCCATCGCCTACGGCC
TGGACAAAGGCAAATCCTCAGAGCGCAACGTGCTGATCTT
TGACCTGGGCGGAGGCACCTTCGACGTGTCCATCCTGACC
ATTGAAGACGGCATCTTTGAGGTGAAGGCCACCGCTGGAG
ACACTCATCTGGGCGGTGAGGACTTTGACAACCGCATGGT
GAACCACTTTGTGGAAGAGTTCAAGAGGAAGCACAAGAAG
GACATCAGTCAGAACAAGAGGGCCCTAAGGAGGCTGCGAA
CCGCATGTGAACGAGCCAAGAGGACGCTCTCGTCCAGCTC
TCAGGCCAGCATTGAGATCGACTCTCTGTACGAGGGCATC
GACTTCTACACGTCCATCACCAGAGCTCGCTTCGAGGAGC
TCTGCTCCGACCTCTTCAGGGGAACACTAGATCCTGTGGA
GAAAGCACTGAGGGACGCCAAGATGGACAAGGCTCAGATC
CACGACATCGTGCTGGTTGGGGGATCAACAAGAATCCCAA
AGATCCAGAAGCTTCTGCAGGATTTCTTCAACGGCAGAGA
ACTGAACAAGAGCATTAACCCTGATGAAGCGGTGGCTTAC
GGTGCCGCGGTGCAGGCCGCTATCCTCATGGGCGACACCT
CTGGAAACGTGCAGGACCTGCTGCTGCTGGACGTGGCCCC
GCTGTCTCTGGGTATTGAGACCGCAGGTGGAGTCATGACG
GCCCTCATCAAGCGCAACACAACCATCCCCACCAAACAGA
CCCAGACCTTCACCACCTACTCCGACAACCAGCCCGGCGT
CCTGATCCAGGTGTTCGAGGGAGAAAGAGCCATGACCAAA
GACAACAACCTGCTGGGCAAATTTGAGCTGACGGGAATTC
CACCTGCGCCACGTGGCGTCCCGCAGATCGAAGTGACCTT
CGACATCGACGCCAACGGGATCCTAAATGTATCGGCGGCG
GACAAAAGCACCGGAAAACAGAACAAGATCACCATCACCA
ACGACAAGGGCAGGCTGAGCAAAGAGGAGATCGAGAGAAT
GGTGCAGGAGGCTGACAAGTACAAAGCTGAAGACGATCTG
CAGAGAGAGAAGATTTCTGCCAAAAACTCCCTGGAGTCTT
ACGCCTTCAACATGAAGAACAGTGTGGAAGACGACAACCT
GAAAGGCAAGATCAGCGAGGAGGACAAGAAGAGGGTTGTT
GAGAAGTGCAATGAAGCCGTGAGCTGGCTGGAGAACAACC
AGCTGGCGGATAAAGAGGAGTACGAACATCAGCTGAAGGA
GCTGGAGAAAGTCTGCAATCCAGTCATCTCCAAACTCTAC
CAGGGAGGGATGCCAGCTGGAGGATGTGGAGCTCAGGCAC
GTGCCGCATCAGGGGCCAGCGCTCAGGGGCCCACCATTGA
AGAGGTGGACTAAAGTTATGAACTCGCATGAACGTCGTCT
GTCAGTCAGAATCCACGTAATGTTTTGACCAAACATATTT
TTATACAACACTGCTGCTCTTATATTTCTGTTGCTATTTA
GCAACCATTCACCACTGTAATTTATTTAAAGTGTACATTG
TGATGTAAATAAAAGTGTAAATATTTTCATGAATTCAAAA
AACTTTTATGTAAAAAAAATATATATATGAAAATGATTAA
TAAAGTGTTTGTACATGAGAAC

hsp70l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hsp70l-002 (1) 1216
mRNA hsp70l-201 2302
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hsp70l-201 Contained in:
OTHER hsp70l-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048952 (1)
  • Ensembl_Trans:ENSDART00000031650 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC154432 (1) 2316bp
    CITATIONS (2)