Transcript

sox10-201

ID
ZDB-TSCRIPT-110325-1214
Name
sox10-201
Previous Names
  • sox10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048700|OTTDARG00000034423|ZDB-GENE-011207-1 sox10|OTTDARP00000038200 sox10-001 LG_ CU695115.21 Danio rerio protein_coding KNOWN, 3205 bp
TTTTTTCTCGCTCTTCACACAACGGGGCTCTTTAAGCCTC
GACGCGCGACACAGAGCAGGCATTCAGAGCGCGAGCGAGG
GGGCTGAACCGACGGACTCTCGCGCTGGGCGGGCGACCTG
CTGCACTGTAAAGTTTCCATCAGATCTATATTCAGAGGAA
GACGGCGGAAGGATTCCTTCTTACAATCTCGAATTATATA
AAAAGAACTGTTAAGGTTTCACTGGATGATCTTAAATAAT
AAACAAAAGCACAGTTGTTTTACAAGAAAAAACATTTGTA
AAGTATAAATAAATACATTTATATTTAAGATAAAATTTAA
GTGAGGAAATTAGACCTACCGAAGTCACCTGTGGCCGCAG
AACGAGTGGACCGATGTCGGCGGAGGAGCACAGCATGTCG
GAGGTGGAAATGAGTCCCGGGGTGTCGGACGATGGGCACT
CCATGTCCCCTGGTCACTCGTCGGGCGCTCCAGGTGGCGC
GGACTCCCCTCTGCCCGGTCAGCAGTCTCAGATGTCCGGG
ATCGGGGATGATGGAGCCGGTGTCTCCGGCGGGGTCTCAG
TGAAGTCCGACGAGGAAGATGACCGGTTCCCCATCGGCAT
CCGCGAGGCGGTCAGTCAGGTGCTGAACGGGTACGACTGG
ACGCTCGTGCCCATGCCCGTGCGCGTGAACTCGGGCAGCA
AGAGCAAACCGCACGTCAAGCGGCCGATGAACGCGTTCAT
GGTGTGGGCGCAGGCCGCGCGCAGGAAACTGGCGGATCAA
TATCCGCACCTGCACAACGCCGAGCTCAGCAAAACACTGG
GGAAGCTGTGGAGACTGCTGAACGAGACGGATAAGCGGCC
GTTTATCGAGGAGGCCGAGCGCTTGAGGAAGCAGCATAAG
AAAGATTATCCCGAGTACAAGTACCAGCCACGTCGACGCA
AGAACGGCAAACCGGGTTCCAGCTCAGAGGCCGACGCCCA
CTCTGAGGGTGAGGTCAGCCACAGCCAATCGCATTACAAG
AGCCTGCACCTGGAGGTGGCGCACGGCGGGGCTGCAGGGT
CACCATTGGGTGATGGACACCACCCTCACGCTACAGGTCA
GAGTCACAGCCCTCCAACGCCCCCTACCACCCCCAAGACG
GAACTGCAGGGAGGAAAATCAGGCGAGGGCAAGCGTGAGG
GCGGAGCCTCTCGGAGTGGACTGGGGGTGGGAGCAGATGG
AAGCTCCGCCTCATCGTCTGCCAGCGGGAAACCGCACATC
GACTTCGGTAACGTGGACATTGGCGAAATCAGCCATGACG
TGATGGCCAACATGGAGCCGTTCGACGTGAACGAGTTCGA
CCAGTATCTCCCACCCAATGGCCACCCGCAGGCGTCCGCC
ACTGCCAGCGCAGGATCTGCAGCGCCATCGTATACATACG
GCATCTCCAGCGCGCTAGCGGCCGCTAGTGGCCACTCCAC
CGCATGGCTGTCCAAGCAGCAACTGCCGTCCCAGCAGCAT
TTGGGCGCAGATGGCGGGAAAACGCAGATAAAGAGTGAAA
CACACTTCCCTGGGGATACAGCGGCGAGCGGTTCACACGT
CACATACACGCCGCTAACACTGCCGCACTACAGCTCCGCC
TTCCCCTCGCTGGCGTCCCGCGCACAATTCGCCGAATACG
CCGAGCACCAGGCCTCGGGATCCTACTACGCCCACTCCAG
CCAGACCTCAGGCCTCTACTCCGCCTTCTCCTACATGGGC
CCCTCACAGCGGCCCCTGTACACCGCCATTCCGGATCCGG
GATCCGTGCCGCAGTCACACAGCCCTACGCATTGGGAGCA
GCCCGTATACACCACACTGTCTCGACCGTGACACACTCTA
CCAAGATGACCAGTCACTAAAGGTCCAACCGTAAGGTGTG
TGTGTGTGTGTGCTAAAAATCATCGAAACACTCGCCTGCA
CCACAATCGACACAAACTGAGATCTGAGAAAAGAGTGTGT
GTGTGTGTGGAGATCTGCAGGGAAATATTCTCACGTGCCT
CAGACGACCACCGTCCAGACCTGCTCCCTCAACGCCAATT
TGAACACCAGTAGTATTTTCGAAAAAGACGTATTACCAAA
GTACCGAGACCAAAACATTACAGAAATACGAGAGTGCATC
CATCCTTCCTGAACTCCGGATATCAGATCACACACAGACT
TCAACACATGATGCTAGTACCTGTGCATCCGCATTTTTTT
ATCTGTATTTGTATGAATGAATAATCTTTTTATTAACCAA
AATAAGGCCATATTGTTTTTAAAAAAATAATGAGGTGTTT
TTCGTTGTTGTAATCTCTTGTGTTGTCGTTACTGTTGTTA
TTTGTGTTGCCATAACTACACTGAAAAGTCTTCACCACTG
TCTAGTGTTTGTTAATGACATTTGTGTTTTATGACTTTCA
GCGTGTGTAAATATCAGTGCCAGGACGCCATACACACATG
TCTCCACCCAATTAAGGTGCGCTCACAGTGACGTTAGTTA
AATTGAGGAATTCCCAACCATGCAAATTCCTCTAGAAATG
GCTATATTTCGTGAAAGCAGTAAATGTGAGCGCACCTTTA
TTTCACACAAGCAGTACTGTAAAGGTAATATATTTTTGCC
AGATTGGAAATAGTGGACGTAATTACGAATTTTTAATAAT
AAATGACTATTTTTAGAGAATACCGCTAGTGCCTCAAGTC
CATCACAAACGAATTGTCGTTTCTGATAAATTCAATTTTG
ATGATGTAAAATCCTTTTCAGGGTGCAAATTTTATCATGC
GTTAACCGATGTGATTATACATCGAATATGCATATGCAAA
TTAATAAGTGCCATTTTTATAATTAAAAATACATCAACTA
TCTGAAGACCTTCCTAACATTGGGTAAGTAAATAAATACA
TTTATTTCATTGTATTATTTTTGGTAAATACAATATTTAG
CTATTCTATGTTTTGTCTCCCTTTGGTACTTTATAGTTTT
GTTTTTGCCCTCTTTATTATTTAGTATTATTCAGAAACAA
ACAAACTCTTTTTATATATTACAGAATATTATTTATATTT
GTTGTTGTTTTTTTTATCAGTAGCGTTTTATTCTGTTTGT
CGTAAACCTCTGTCGTGTGCTGTTGTGGTGGGTTAAAGTG
CTGTTGTTTTTCTCTGTCGGTGTAAATAGAACTGAGAGCA
GTGACTAACTTTCCTCACTCTAAATAAAGCTGCAGTCTTT
ACGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations