Transcript

fgfr2-205

ID
ZDB-TSCRIPT-110325-1003
Name
fgfr2-205
Previous Names
  • fgfr2-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047852 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047852|OTTDARG00000033929|ZDB-GENE-030323-1 fgfr2|OTTDARP00000037560 fgfr2-004 LG_none FP102866.5,CU639430.5,CU862017.12 Danio rerio protein_coding KNOWN, 2448 bp
ATGTTCGCCCGAGGGTGGCTTCTGGGTGCTCTCCTGCTAA
TGACCCTGGCAACGGTATCTGTGGCACGGCCGTCATTGAA
GATTGACTTGGTGAATACATCTGCACCTGAAGAGCCTCCA
ACCAAAAACCAAAACTGTGTGCCCGTCCTGTTCTCGGTGC
ACCCGGGTGAGCTGCTCAAGCTCAAGTGCCCGCTGTCCGG
GGCAGATGACGTCGTCTGGACCAAAGACAGCTCCTCGCTG
CGCCCCGACAACCGCACGCTCGTAACTCGGGATTGGCTGC
AGATCAGCGACGCCACCCCGAAGGACTCGGGCCTGTATTC
GTGCAGTGCCACGGGCTCGCGGGACTGCGATGTGTTTAGC
TTCATCGTAAACGTTACAGATGCCATCTCATCCGGTGACG
ATGAGGACGACACAGAGCGGTCAGACGATGTTGGGGCAGA
CGGTGAACAAATGCGGCTGCCATATTGGACCTTTCCAGAG
AAGATGGAGAAGAAGCTGCATGCCGTCCCGGCGGCCAACA
CGGTGAAGTTTCGCTGCGCGGCAGCCGGAAATCCTAAACC
CAAAATGCGCTGGCTGAAAAACGCAAAACCCTTCAGACAG
GAGGATCGCATGGGCGGCTACAAGGTTCGACTCCAGCACT
GGACCCTGATCATGGAGAGCGTGGTTCCCTCTGATAAAGG
AAACTACACCTGTCTGGTGGAGAACCAGTATGGCTCCATC
AATCACACATACACGCTGGATGTCGTTGAACGCTCTCCTC
ACCGGCCCATTCTCCAGGCAGGCCTGCCAGCAAACGTCAC
TGTGCAAGTTGGACAAGATGCGAAGTTCGTCTGTAAAGTT
TACAGTGATGCTCAGCCTCATATCCAGTGGTTGCAGCACT
ATACGAAGAACGGCAGCCGCTATGGTCCTGATGGACTTCC
TTATGTCCGCGTATTGAAGAGCTCGGGCATAAACAGCTCG
GACGTGGAAGTCCTCATGCTCACCAATGTCACAGAAGAGG
ACGCTGGTGAAATTACGTGCAAAGTGTCCAATTATATTGG
TGAGGCCAACAATTCCTGTTGGCTCATTGTCATACCAGCT
GAGACGAATCCCATCGAGACGGATTATCCTCCAGATTATG
TGGAGATCGCCATCTACTGTATAGGTGTGTTTCTGATCGC
CTGTATGGTGGTGATCGTGGTGGTTTGCCGGATGAGGACG
TCGGCTAAGAAGCCTGATTTCAGCAGTCAGCCAGCAGTGC
ACAAGCTCACCAAACAGATCCCCCTGCGCCGCCAGGTAAC
AGTGTCGTCAGACTCCAGCTCCTCCATGAGCTCTAGCACG
CCATTGGTCAGAATCACCACTCGCCGGAGCTCCGCCCACG
ATGATCCCATTCCAGAATACGACCTCCCTGAGGACCCACG
CTGGGAGTTTTCTAGAGACAAGTTAACTCTGGGTAAGCCT
CTCGGCGAGGGCTGCTTTGGTCAGGTTGTGATGGCTGAAG
CTCTTGGCATTGACAAGGACAAACCGAAAGAGGCTGTGAC
TGTGGCTGTCAAGATGCTAAAAGATGATGCGACCGAGAAG
GATCTTTCTGACCTGGTGTCAGAGATGGAGATGATGAAGA
TGATTGGCCGGCACAAGAACATCATCAATCTGTTGGGAGC
GTGCACACAGGATGGTCCATTATATGTCATTGTTGAGTAT
GCATCTAAAGGGAACCTCCGGGAGTATCTGAGGGCCCGGC
GGCCCCCAGGAATGGAGTATTCCTATGATATAGCCCGCGT
ATCAGATGAGCCTCTCACTTTCAAAGATCTGGTCTCCTGC
ACTTATCAAGTTGCCCGTGGCATGGAGTATTTAGCCTCTC
AGAAGTGTATACACCGAGATTTGGCCGCGAGGAATGTGTT
GGTCACGGAGAGCAACGTTATGAAGATCGCAGACTTCGGT
CTGGCCAGAGACGTCCACAACATAGATTACTATAAAAAGA
CCACAAATGGTCGTCTGCCTGTGAAATGGATGGCTCCAGA
AGCACTGTTCGACCGAGTTTATACACACCAGAGTGACGTC
TGGTCGTTTGGGGTTTTAATGTGGGAGATCTTCACTCTCG
GCGGTTCTCCGTATCCTGGAATACCTGTCGAGGAGCTCTT
TAAACTATTAAAAGAGGGTCATCGCATGGACAAACCTGCT
AACTGCACCAATGAGTTGTACATGATGATGAAGGACTGCT
GGCATGCCATCTCCTCCCACAGACCCACATTCAAGCAGTT
GGTGGAGGATCTGGACCGCATTCTCACTCTGGCAACCAAC
GAGGAATATCTGGACCTGTGTGCCCCGGTGGAGCAATACT
CTCCCAGCTTCCCCGACACACGCAGCTCCTGCTCCTCCGG
AGACGACTCCGTATTTTCCCATGATCCCTTAGCGGACGAG
CCCTGCCTTCCCAAATACCAGCACATCAACGGCGGCATAA
AAACATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations