Transcript

kcnv1-201

ID
ZDB-TSCRIPT-100915-979
Name
kcnv1-201
Previous Names
  • dkey-201i6.2-001
  • si:dkey-201i6.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047210 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047210|OTTDARG00000033560|ZDB-GENE-100922-109 si:dkey-201i6.2|OTTDARP00000037109 DKEY-201I6.2-001 LG_ BX511123.10 Danio rerio protein_coding NOVEL, 1970 bp
GCCATAATAACTGAGAATTTTATTCAGCGAGAGTTAAAAA
TAAACCCAAAATATAAAAAATCAGAAATATATGTAATTTT
CATTATTAATTTAGGTCAGCAGCCAAATCCTCATTATTAT
TGATACTGCTCTTTCCACGGTGTGAAACTAATGCACTTCA
AATGTGCTCTTCTGGATCTCTCAGGGCTCACGTAACTCAG
AGCATCATGATCACGGATTCATCAAGTCCGGCGGAGTTTT
ATGAGGACAACGCTTCGCTGTTGTCCTTGGACTCGAGTGT
TTTCTTCAGCGAGCCTGCGCTTCCGACTGACGATCCACTG
GAGTTCTTCATTATAAATGTGGGAGGAAGCCGCTACATCC
TCTCTCAGGAACTGTTGGCCTCTCATCCAGAAACTCGTCT
AGGAAAACTGGCCCTTTCCAGTCGAGACTCTGCTTTGGAT
CTGTGCGACGATGCCGATTTCCTGGAAAACGAGTACTTTT
TTGACCGCAACTCACAGACCTTTCAGTACATTATGAACTT
TTACAAAACAGGCCACTTGCATGTGAGAGAGGAGTTGTGT
GTGATCTCGTTCCTTCAGGAAATCGAGTACTGGGGCATCG
ATGAGCTTCGTATTGACAGCTGTTGTCGGGACAAGTACTA
CCGCAGGAAGGAAATGAAGGAGTCTTTGGATATTCGCAAA
GATGCTGACGTCATGGACAAGGAGGAGGAGGACTTTACTG
GTGTTTTGTGCCAGGATTTACGCCAGCGTCTATGGGACAT
CATGGAGAACCCGGATTCCTCCAAGGCGGCCAAGACGTTT
GGGACGCTCTCCATGTTTTTCGTGGTGGTGTCCATCGTGA
ACATGGCTTTGATCTCGCTGGACTTCTCTGTAATTGGTGC
ACCCATCATCTTGGACATTCTTGAGTACATTTGCATCATT
TGGTTCACCGGAGAGCTGGTGCTCAGGTTCTTGTGTGTTA
GAGATAAATGTAAGTTCAGCAGGAGCGTGGTGAATATCAT
TGACCTGCTGGCCATTCTGCCCTTCTATGTGACTCTGGCA
GTGGAGAGCCTGCATGGAGAATCGACAGAGCTGGAAAACG
TAGGACGGGTCGTTCAGGTGCTGCGGCTGATGAGGTCGCT
GAGGATGCTGAAACTCGGACGACACTCCACAGGTCTCAAG
TCTTTGGGCTTGACGATTGCCCAGTGCTATGAGGAAGTTG
GTCTCCTGATGCTGTTCCTATCTGTGGGCATCTCCATCTT
CGCCACTCTGGAATACGCTATTGAACATGACACGCCAGAA
ACCACCTTCACCAATGTCCCCAGTGCCTGGTGGTGGGCTA
CCACATCCATGACCACGGTAGGGTATGGAGACATCCGTCC
AGACACGGCTGTTGGAAAGGTGATGGCCTTTATCTGCATC
CTATCAGGGATCCTTATCCTGGCGCTGCCCATCGCCATCA
TCAATGACCGATTCTCCGCCTGCTACTTCACTCTTAAAAT
GAAGGAAGCTGCACTGAGGCATGGGGAGGTGCTGAAGAGA
CTGACCCGCAGCTCAGCCTCAGATATGTCGGCGATAGGGG
TGAACCTGCGGGACGTCTATGCCAGAAGTGTGCTGGAGAT
GCTGCGGTTGCAGGGCAGAGAGCGAGCCAGCACACGCAGC
AGTGCAGGAGATCTCTGGTGGTAACAGTAGGTCTGCAGCA
TGCTGGTGCAGAAAGAGATACTGAAGTTTTTTTACAGACC
ACTCTCATATGACAAGGAATCAAAATGTGTTTGCTGAAAT
AGGAAATCATATCGCAACTTGCCTCAAACCATAATTTTTA
AAAAAATTACTGCAAAAAACTCTGAAATGCTCATGTTTCT
GGCGTCATGCCACTGATAATAATTCCTAACACTGTGTCCT
AACTACATGCGATTCAATGCCGCAACATGCAATAATAGCA
ACTCAGGCTCATTGTGGATACATACCAAGGCCTAAATTGC
TGTGAAACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations