Transcript

slc6a19b-201

ID
ZDB-TSCRIPT-100915-940
Name
slc6a19b-201
Previous Names
  • slc6a19-001
  • slc6a19b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047050 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047050|OTTDARG00000033457|ZDB-GENE-030131-4755 slc6a19b|OTTDARP00000037020 slc6a19-001 LG_none CT027701.11,CR391912.9 Danio rerio protein_coding KNOWN, 2538 bp
TCTAGCCCATCAGAGACTGAGCCACCGGAGATCATGAAGC
TGAAGCTGGTGCTGCCGAACCCGGGTCTTGAGGAGCGGAT
CTTGAACCATGAGGCGCTGGAGAGGCTGGAGGTGGAGGAG
GCTGGAGACAGACCCAAGTGGGACAACAAAGCCCAATACA
TGCTGACCTGCGTGGGCTTCTGTGTGGGGTTGGGCAATGT
CTGGCGGTTCCCCTACTTGTGCCAGAGCCATGGAGGAGGT
GCCTTTATGATTCCTTTCCTGATCCTGCTGGTTTTTGAGG
GAATCCCTCTTCTCCATCTGGAGTTTGCCATCGGGCAGCG
ACTGAGGAAAGGCAGTGTGGGTGTCTGGAGGACTATTAAC
CCATATATGCTTGGAGTTGGCATTGCATCTATGTGTGTGT
CTTTTCTGGTCAGTCTGTACTACAACACCATCATAGCCTG
GGTTATGTGGTATTTCTTCAACTCCTTCCAGGATCCTTTG
CCCTGGAGCCAGTGCCCCATCAATGAAAACAGAACAGGAC
CGATTCCAGAGTGTGGGAAGAGCTCACCAGTGGATTATTT
CTGGTATCGTGAGACTCTGAACACTTCAGCGGCTATAGAT
GATACGGGTGGTCTGCAGGTGTGGATGGTCCTCTGTTTGA
TCTCTGCATGGGCAGTGCTGTATGTCTGCTGCATCCGTGG
AATAGAAACCACTGGGAAGGCGGTATATGTGACGTCTACG
TTACCGTATTTGGTTCTTACGATCTTCCTGATTAGAGGAC
TCACTCTGAAAGGATCCGTTGATGGAATTAAATTCCTCTT
TACTCCAGATATAAACGAGCTGGCAAACCCTAGCACATGG
CTGGATGCTGGTGCACAAGTGTTTTATTCATTTTCTCTAG
CTTTTGGAGGTCTCATCTCTTTTTCCAGCTATAACTCTGT
GCACAATAACTGTGAGCAAGATGCAGTAATCATCTCTGTC
ATTAATGCGTTCACTTCCATCTATGCGGCCACTGTCATTT
ACAGCATAATTGGTTTCAGAGCCACAGAGAGATTTGATGA
CTGTATGAATGGGAACATCTTGACTCTTCTGAACACATTT
GACCTGCCAGAGGGGTTCATCAATCAAAGCAACTATCAAG
ATGTTTTTCAGAGCCTTAATTCTACAAGCCCTGACATAAT
CAGCAGCCTTAGCCTTAAGACCTGTGATCTGAACAACTTC
CTCAGTGAGGGTGTAGAAGGAACGGGTCTTGCCTTTATTG
TGTTCACTGAGGCAATCACCAAGATGCCACTGTCTCCACT
CTGGTCCGTCCTGTTCTTCATTATGCTCTTCTGCCTTGGC
TTGTCCTCCATGTTTGGCAACATTGAGGGTGTTCTGGTTC
CCCTGCAGGACCTAGGGGTCTTCCCCAAAAGCTGGCCTAA
GGAAATTATTTCAGGTGTGACGTGCTTGGTGTGCTGTCTG
GTTGGGCTGATATTTGTCCAGGGCTCAGGAAACTACTGGC
TGGCCCTATTTGACAGCTTTGCTGGCTCTATTCCTCTCCT
CATTATTGCTTTCTCCGAGATGATTGGAGTTGTATACGTT
TATGGCATTGACAGGTTCAATGAAGACCTGATATTCATGA
TAGGACACAAACCTAACATCTTCTGGCAAGCCACATGGAG
ATTCATAAGCCCTCTCATCATGTTGGCCATCTTCGTTTTT
TACTTTTCCACCACAGTCACCAAGGAAATCTTTTACAGCG
CTTGGGATCCTGAATCGGAAAATTTCCCAACTCTAGAGAA
GAAGCCATATCCAACATGGATCTACGTAATAATATTTCTG
CTGGCTGGGGTTCCTAGTTTGGCTGTACCAGGAACTGCTG
TTTTCAGAGCCATTCGAGACTATTGCTGCAAAAAACATCC
CAGTGCTTCAATTCAACAACTAGATTCTGTATCTTACAAA
GTTCAAATGCATGATGAAGAAGTGAAGACACAAAAGACTG
AGAAATTTGACCAAAAGTTGTATACATGAGATCTAACTGA
ACCTGCTATGCCATAATTTTAGGCCCACACATACATAAAT
GTCTTTCTGGAATTGACAGATTATTGCTATAATATTTGCC
CTTGAAAATGTGCTTGCAAAATGTTACAGTGGTTTCAACT
TCCAGTTTCCAATTTTCCATTAAAATTTAATTTACCAACA
GTACACAGATAAAGCTAAGACACTAAATTAGGGCTTACTG
GATTAGAGAGATTAATATATTTTTAATTGGTTATATATCA
TTTAAAATATATGCAATTTTATACACATTTTAAGAAATAA
GAAAAGATAAAAAGTAATGATGATAAGAAAACTGTGTGGC
TAATTTGATAGTGGTACGTGGCAGACATGTTTTTGTGCTT
TAAAATATTGATAAGCGTATTTATTTTTGTAACAAATAAT
GGCATTTAATTGGACTTTTTAATGTTTCACCCAATCAGTC
TTCCTCAAAAAATATGTTCTGATAAAGGATTTTGGCCATG
TTTCCCGACGAGTTCAATAAATATTTGTCTATGCCTATAA
ATTTGGTTCATTTAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations