Transcript

sostdc1a-201

ID
ZDB-TSCRIPT-100915-646
Name
sostdc1a-201
Previous Names
  • ch73-144m15.2-001
  • sostdc1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045896 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045896|OTTDARG00000032791|ZDB-GENE-050417-64 sostdc1a|OTTDARP00000036212 CH73-144M15.2-001 LG_ FP102309.6 Danio rerio protein_coding KNOWN, 1344 bp
AGTGTTTCTCTGGGTGTGGTTTAGAGAGAGGGAGACGTCC
TGCCCTTATTTTATCATCCCGCTCACCTGAGCCTTTGCCA
AATCCGGAGGCGGGAGTGTGTATATATACTGAATATATAT
AACCCAAGACATGATGATAGTTAGTGAGAGTCATTCAGAG
TTGAAGCACATCTCTCCATTGGCCGTGGGTCATTACGCAT
CGCCATGTATATAAACGCACCAGAGTCGTGCAATTTCATG
GTTTTATTTTGCTTTTTAATAAGGAGTGGTTTGACTTTGA
AGAACGATGCTACGGAGATTTTCTACTCGCATGTGGTCAG
TCCCGTTCAGGATGCGCAGAGCAACGCGTCTCTCAACCGC
GCGCGCTCCGGAGGAAGAGGCTTCAGCACGCACGACAGAG
AACGAATCCCAGTAGGCTGCAGAGAGCTCCGATCCACCAA
GTACATCTCAGATGGCCAGTGCACCAGCATAAACCCTGTG
AAAGAGCTGGTGTGCACAGGACAGTGCCTCCCCGCTCAGA
TGCTGCCCAATTGGATTGGAGGATACGGCAAGAAGTCCTG
GAACCGCCGGAACAGTCAGGAATGGCGCTGTGTAAATGAC
AAGACCCGAACTCAGCGGATTCAGCTCCAGTGCCAGGATG
GCAGCACCAGGACCTACAAGATCACAGTGGTGACCTCCTG
CAAATGCAAACGATACTCGCGGCAACACAATGAATCAGGA
GTTAAGTCTGAGGGATACTCTCATAGCCAGATCAAAAAAC
AGAAAAGCAAAGTGGCCACCAGGACAGAAAGCTAAATAAG
TCTCTGCTTGAACTGACCTTAATATAGAATTGCTGGCACT
GAACTTTCTTTGAGAGCAAGTGCAGGGCTCAGAGTTCACT
GTGAAAGACATCAACATAATCACAATTAACATGAGGCCTT
TGTGACCCTGTGCTGGAAGAGATGGACAATGACAACAGCA
TATTGCCTTACAAAAATGATTAGAAACAGACTCGTGATCC
TGATTGCTTTTGTTGTCTCCGTCTCATATGTGTGGCAATC
ACTTGCTGTAGTTTATGCTGTAAGTTTATGTGTTCAGCGT
CAATACATGTAGTTCTCAAACCCGAGAAATGCATAGCTAC
CTGTAAATACAATGTTTGTATATATGCCTATGCATTTCTT
TGTTATTAATCGTTTTGCAGGACCTCTATGTGTTAAAAAA
GCGGATGTAATATATTTTGCCTTGACTTTGCTGACTTTAA
AATATTTTTAGTTTGTGCAAGCATTATTCAGACAAGATAT
TGCACTATAGTGACAATGTTCATATGAGCTATTATGATGT
AAAACTATTAAAATGAAAACATCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations