header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-560
Transcript Name: csnk2b-201
Previous Names: ck2b-001, csnk2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044193 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044193|OTTDARG00000031721|ZDB-GENE-990415-29 csnk2b|OTTDARP00000034992 ck2b-001 LG_none FP067441.5,FP017214.1 Danio rerio protein_coding KNOWN, 1659 bp
CTAACATCGACCCCGGGAGATCCTTGAGGTAACTTTCCCA
ACATGAGTAGCTCAGAGGAAGTGTCGTGGATTTCTTGGTT
TTGTGGTCTACGGGGAAATGAATTCTTCTGTGAGGTGGAT
GAGGACTATATTCAGGACAAGTTTAATCTTACAGGACTCA
ACGAGCAAGTTCCCCATTACAGACAAGCTCTGGACATGAT
CCTCGATCTGGAACCTGATGAGGAGCTGGAGGATAACCCT
AACCAGAGTGACCTGATTGAGCAGGCTGCTGAGATGCTCT
ATGGGCTGATTCATGCTCGCTATATCCTCACTAACCGTGG
CATTGCCCAGATGCTGGAGAAATATCAGCAGGGAGACTTT
GGCTACTGTCCTCGTGTTTACTGTGAGAATCAGCCAATGC
TGCCTATTGGCCTCTCTGACATTCCCGGCGAGGCTATGGT
GAAGCTCTACTGCCCCAAGTGTATGGATGTGTACACGCCG
AAGTCATCCAGGCACCATCACACTGACGGAGCTTACTTTG
GCACCGGCTTCCCTCACATGCTCTTTATGGTGCATCCCGA
GTACCGGCCAAAAAGGCCTGCCAACCAGTTTGTGCCCAGG
CTTTATGGTTTTAAGATTCACCCAATGGCTTACCAGCTCC
AGCTGCAGGCAGCCTCCAGCTTCAAGAGTCCCGTCAAAGC
CATCCGCTAAACACCTGGGATGGGATGGGATGGGGTGGGG
TGGGATGTCGGGTGGGTTGTGTGTCCGTCAACAAGGGCTC
ACTCTTCTCCTTCGATTTGACCGAGACTAACATTTAAATG
TGGAGAGAGTGAGACTGTAAAACACTGGGGAGAAACTAAA
AGCTTACCTCTGAAACACTGTACAGAAAATGAGGTGTTCC
TTGTAAAAAAAACAAACTTCTTTCAGTTCTCAACCTCCAC
ATAGAAAATAAAGATCTACTTAAAGATAGATAACTGTAGG
ATGGCTCTGCTCGCTCTCTGGTTACTGTTTGTTTTAGTTT
GCTAATGCTAACATATAAAACAGTCTTGAATTGATGTCTT
GTCAGTTCTCGGCATGGTGGATGGTTGGCTTTGAATGTAA
AAGTAGGGTTGATTGGTCATCAAAACCCCATTTAAATTGG
CTCAATCCCCTTCTCTGATATTTGGCTTATTGAAATAAAA
AGGAAGGCTGTTGCATGATATATGCAGTATGTTTTGGGTT
TAAGTGACGTCGCTGGGATTGTCTTTGACTGTTTTTTGTT
GACAGACTGCAAGCTTTCACCGCATGCATAAGATAAGAGC
AGAAATGGGAAGACAAGTGTAATCAGGAAACGCCATCTTA
ATTCGACATGTTTTTGTTTTAATATTTGGTACTGCACTCT
TCTTCAGATTGACGCCAACCTGCTGCGTTCCTCCAGTGTC
CAGATTCTTCAGACAAATTTGATTAGATTGACCAGAGTTA
GGATGTTTTTTATGTTTGGTATGGGCCCAGGTTTTTCTTC
TCTTGTTTAAAGTATTTCTTCTGGTAGAGAAGAGTCAGAG
TAGAAAATATAAAATGGGTTTAAATGCATTTCTTTTGTGT
GTGCTATTTCTTTTCTTTGATCCTGTTGAATGTTTTTTTT
CCTTTACAGCTATTGAGGAACCAGGGTTCAGAATTCACAA
TAAATGTCTTTTCCTACAA

csnk2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA csnk2b-002 (1) 1914
csnk2b-003 (1) 768
mRNA csnk2b-201 1659
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csnk2b-201 Contained in:
[Fosmid] CH1073-121K17 (1) (order this)
OTHER csnk2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044193 (1)
  • Ensembl_Trans:ENSDART00000109258 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162496 (1) 981bp
    GenBank:BC162490 (1) 976bp
    GenBank:EH452604 (1) 926bp
    GenBank:CT653185 (1) 880bp
    CITATIONS (2)