Transcript

es1-201

ID
ZDB-TSCRIPT-100915-550
Name
es1-201
Previous Names
  • es1-001
  • es1_2-001
  • ottdart00000043862
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043862 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043862|OTTDARG00000032517|ZDB-GENE-980526-188 es1|OTTDARP00000034765 es1-001 LG_none FP017299.16,FP015956.11 Danio rerio protein_coding KNOWN, 1057 bp
GTAGCTTACAGAGTGACGTCTCGCACACCACTTCAGTATA
AAAGAGCATCAGGATCCACCCGCTGTGTTCAGATTTCTGT
CACTTTATCTCTCTGTGTGTTTTAAAGCTACAGTAAATCA
GTCATGTTGGCATCACGGGCTCTCCTCGCCAAGCAGGCCG
CAGCCATGCTGGTGCGTCAACCTGCCTGCCTGATGCATCA
CGGGGGAGACTGGGGCAACTGGGGCAACACCAACATCGCT
GTGGTTTTCTCTGGTTGTGGTTGGTGGGACGGGACTGACA
TCCATGAGGCTGCATACACCATGTACCACTTGAGCCGTAA
TGGAGCCCGTTTTCAGATCTTTGCTCCAAACCAGCAGCAA
ATGCATGTCATGGATCACATGAAGATGCAGCCATCTTCCA
GCGACAACAGGAACATGATGATGGAGTCTGCGCGATTCAG
CCACGGTCAGGGAATGATGCAGATGAACGATCTGTCCAAA
CTGGACGCTAACAGTTTTGATGCCGTCATCTTTCCTGGAG
GCCACGGCATCGTCAAAAACATGTCCACCTTCAGCAAAGA
TGGCAAAGACTGCAAGTTGAATAATGACGTGGAAAGAGTT
CTGAAGGACTTCCACCGCGCTCGCAAACCCATTGGGTTGT
CCAGCATGGCTCCTCTCCTAGCGTGTCGAGTTCTGCCCAG
TCTGGAGGTCACGATGGGTTATGAGCGGGACGAGAGCAGC
CGCTGGGGCCGCTGGCCAAACACCAACATGGTGCAGGCGG
TCAAGAGCATGGGGGCCCGTCACAACACCCGTGAACCTTA
CGAAGCCTATGTGGACGAGAAAAACAAGGTGATCAGCACT
CCGACCTTCATGTGGGAGACCGACTACCACTACCACTACA
TCTTTGACGGCATCGGGAACATGGTGAAGCACGTCATGCG
CATGACCGCCAAATGAGTCTCACCAGAACACAAACACCTG
AAGGCTTTCACACTTAACTTTAGGTTGACCAGAATCCACT
GTGATGTGGGCGTACAGAGAGTAAATAAAGAAAAGCATGC
AATGCAACTCCGCTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations